MEIS : ­ 2007 ­ 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...

Еще в разделе: (Показать все результаты (>98) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/Mashkova_NIMBInPress_ErosionC-Fiber.pdf

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>9) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ им.М.В.Ломоносова

... Main page News People . ... Master net Homepage . ... SAI MSU 20-21 March 2014 . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Science committee: . ... E.S. Gorbovskoy (SAI MSU) . V.M. Lipunov ( chairperson, MSU, SAI) . G.V. Lipunova (SAI MSU) . ... M.V. Pruzhinskaya (SAI MSU) . A.M. Cherepashuk (MSU, SAI) . N.V. Tyurina (SAI MSU) . N.I. Shakura (SAI MSU) . ... The conference is organized by the Zel'dovich Moscow Astrophysics Seminar ( master.sai.m su.ru/osa/ ) . ...

Еще в разделе: (Показать все результаты (>14) - master.sai.msu.ru/ )

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

Red Square at Night . The guide books were wrong when they told me that Moscow is dreary in November. ... The sound stands in contrast with the enormous bustle of Moscow. I teach in the Humanities building, a large rectangular steel and glass mirror just out of the shadow of the skyscraper that symbolizes Moscow State University. Getting in and out of the Humanities building means edging into a fast-moving stream of students and faculty who are hustling to class. ...

Еще в разделе: (Показать все результаты (>18) - suny.msu.ru/ )

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>9) - lcc.chem.msu.ru/ )

University Satellites and . Space Science Education . ... Subjects of collective training courses and teaching seminars concern with particular stages of development of the remote sensing methods of research. 6 teaching seminars organized at the base of Moscow University to the middle of 1990's were devoted to: - interpretation of multiband aerospace images ; computer interpretation of aerospace images ; remote sensing and geoinformatic; educational GIS;. space images in school ...

Еще в разделе: (Показать все результаты (>56) - cosmos.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>91) - npidb.belozersky.msu.ru/ )

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>16) - temporology.bio.msu.ru/ )

• A FREGIMO AMISSA - Научный адъ

Alexey N. Romanov, Zukhra T. Fattakhova, Denis M. Zhigunov, Vladimir N. Korchak, Vladimir B. Sulimov. On the origin of near-IR luminescence in Bi-doped materials (I). Generation of low-valence bismuth species by Bi3+ and Bi0 synproportionation // Opt. Mater. 2010, doi:10.1016/j.optmat.2010.11.019 . Creation of bismuth-containing near-infrared (NIR) luminescent centers by synproportionation reaction of Bi3+ and Bi0 was demonstrated in borate and phosphate glasses. ...

Еще в разделе: (Показать все результаты (>123) - srcc.msu.ru/ )

• A.Romanov, Z.Fattakhova, D.Zhigunov, V.Korchak, V.Sulimov // On the origin of
• E.P. Gordov, M.V. Kabanov, V.A. Krutikov, V.I. Kuzin, V.N. Lykosov, I.G.
• Kazakevich, Olga [Казакевич О.А.]. Language functioning and language changes in

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>1229) - swx.sinp.msu.ru/ )

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>83) - textbook.sinp.msu.ru/ )

• Index of /modules/ax_content/atomax/spaw/lib/themes/default/img

... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...

Еще в разделе: (Показать все результаты (>2) - silab.sinp.msu.ru/ )

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>19) - polit.msu.ru/ )

• Новости факультета

... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...

Еще в разделе: (Показать все результаты (>3) - olymp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>70) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/prokhorov/index.htm
• http://chaos.phys.msu.ru/loskutov/PDF/Galss_ceramics.pdf

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>15) - heritage.sai.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>6) - tex.bog.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление