... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
) REGUL ATION (EC) No 1906/2006 OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 18 December 2006 laying down the rules for the par ticipation of under takings, research centres and universities in actions under the Seventh Framework Programme and for the dissemination ... relevance) THE EUROPEAN PARLIAMENT AND THE COUNCIL OF THE EUROPEAN UNION, (3) Having regard to the Treaty establishing the European Community , and in particular ... Article 48 Article 50 Principles Access rights for use 1. ...
... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
February 11, 1997 Neurokinetics Case Study Background 2 The Bionic Glove 2 Details 2 Development 3 Commercialization 4 The Issues 4 Intellectual Property 4 The Market 5 Distribution 7 Clinical Trials 7 Product Development 9 Regulatory Considerations 10 Sales Projections 11 Financing 12 Commercial ... Research indicated that the target market for Canada and the United States combined was approximately 76,850 existing patients with 2,850 new patients anticipated each year. ... patients | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005 Похожие документы
... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...
... Seminar archive . ... Type Ia Supernovae (SNe Ia) have an important role to measure a distance to an anonymous galaxy because they have a good correlation of the decline rates of the light curves with the absolute luminosity. ... First, super-Chandrasekhar SNe which have extremely high luminosity, slow decline rate of the light curves, slow expansion velocity and strong carbon features. ... As another example of diversity of SNe Ia, I would like also to introduce Type Iax SNe. ... All seminars: . ...
Curriculum Vitae . ... Degree: candidate of science in mathematics and physics (PhD), obtained from Lomonosov Moscow State University (2006) . ... 2003 - 2006 . Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... Kurchatov student scholarship at Lomonosov Moscow State University . ... Young Scientists Summer Program at International Institute for Applied System Analysis ( Laxenburg , Austria ) . ...
... The method of polariton scattering spectroscopy is based on the effect of the spontaneous decay of a pump photon (w 1 , k 1 ) into a signal photon (w s , k s ) and a polariton (w p , k p ) in a nonlinear crystal without the centre of symmetry. ... The higher-order vibrations, as a rule, make small contributions into the dispersion dependences of linear and nonlinear susceptibilities and are difficult to study by means of traditional Raman and IR methods. ...
... This assumption is grounded in the classical theory of stationary turbulence in the limit of infinite Reynolds number (e.g. Corrsin, 1951). ... The ratio of diffusivities is obtained as a function of buoyancy Reynolds number Reb and of the density ratio R (the ratio of the contributions of heat and salt to the density stratification). ... The main results are in section 5, where potential energy components, scalar variances and turbulent diffusivities for the two scalars are examined. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf -- 2298.1 Кб -- 11.11.2009 Похожие документы
... BMC Genomics 2013, 14:745 http://www.biomedcentral.com/1471-2164/14/745 DATABASE Open Access RegPrecise 3.0 A resource for genome-scale exploration of transcriptional regulation in bacteria Pavel S Novichkov1*, Alexey E Kazakov1, Dmitry A Ravcheev2,3, Semen A Leyn2, Galina Y Kovaleva1,2, Roman ... Inna Dubchak1 and Dmitry A Rodionov 2,3* Abstract Background: Genome-scale prediction of gene regulation and reconstruction of transcriptional ... Figure 5 The regulog page in RegPrecise. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom2_2013.pdf -- 1974.9 Кб -- 15.12.2013 Похожие документы
Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...
... Spectrum and autocorrelation of the compressed pulses are shown in Suppl. Fig. ... L E M E N TA R Y I N F O R M AT I O N 2 Background pressure: 10 mbar -9 Turbo pumps suited for high gas flow Two-component VIS/ XUV mirror - delay stage (removable) 5fs phase-stabilized laser pulse HHG target Detection of Adjustable background-gas ionization iris due to HHG beam in the tube Target XUV grating (removable) XUV CCD Filter vacuum separation XUV mirror (focusing) ... Laser Phys. Lett., ...
... Outflows, proceeding during decades result to formation of oil secondary deposits. In a near-surface zone, oil pollution becomes especially chemically active and reacts with geological environment, that results in the anomalies of various geophysical methods: SP, IP, GPR and resistivity. ... The DAS, AM AMN algorithm of median polishing was offered by J.W.Tukey (1981), Rmin ABmin and after modification made by E.V.Pervago was applied for proc5 essing of Total Electrical Sounding (TES) data. ...
ISSN 1560-3547, Regular and Chaotic Dynamics, 2007, Vol. ... RESEARCH ARTICLES Interaction between Kirchhoff Vortices and Point Vortices in an Ideal Fluid A. V. Borisov* and I. S. Mamaev ** Institute of Computer Science, Udmurt State University, Universitetskaya ul. 1, 426034 Izhevsk, Russia Received March 1, 2005; accepted January 14, 2006 Abstract--We consider the interaction of two vortex patches (elliptic Kirchhoff vortices) which move in an unbounded volume of an ideal incompressible fluid. ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/099/147-interaction-between-kirchhoff-vortices-and-point-vortices-in-an-ideal-fluid_ru.pdf -- 359.3 Кб -- 28.10.2015 Похожие документы
... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...
... Vice-Dean, Physics Department, M.V.Lomonosov Moscow State University . Vice-Director, International Laser Center, M.V.Lomonosov Moscow State University . ... International Laser Center and Faculty of Physics . ... Radiophysics including Quantum Electronics . ... Victor Zadkov's current research interests are in the field of laser physics, interaction of laser radiation with matter, molecular dynamics of photoexcited molecules, coherent control, quantum optics and physics of quantum information. ...
... In particular spectral distributions of single counts and coincidence for pure biphoton states generated by a train of short pump pulses have been measured and the entanglement quantifier has been calculated. ... Considering that the pulse duration of the pump did not change we can observe that in this case the pump is 2.8 times greater than the coincidence spectrum whereas the single counts distribution is 64 times larger than the width of the pump. ... Phys. Rev. Lett., ... Phys., 9 (2006) S467. ...