. September 999 . Mon . Tue . Wed . Thu . Fri . Sat . Sun . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . 10 . 11 . 12 . 13 . 14 . 15 . 16 . 17 . 18 . 19 . 20 . 21 . 22 . 23 . 24 . 25 . 26 . 27 . 28 . 29 . 30 .

Еще в разделе: (Показать все результаты (>4492) - fmp.msu.ru/ )

• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=9&year=1005&catid=35&Itemid=1165
• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=9&year=1004&catid=35&Itemid=1165
• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=9&year=1&catid=35&Itemid=1165

... Home News BHP meeting . Delegation of the well-known Great Britain тАУ€аAustralian Company BHP Billiton visited Chemistry Department of MSU and specifically the Laboratory of Chemical Thermodynamics on September 14, 2007. ... Colloquium on 24.10.07 . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Colloquium on 19.10.12 15 Oct 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>8) - td.chem.msu.ru/ )

• Colloquium on 08.09.10 Laboratory of Chemical Thermodynamics
• Colloquium on 23.09.10 Laboratory of Chemical Thermodynamics
• Laboratory workshop on 20.09.11 Laboratory of Chemical Thermodynamics

... Полная версия этой страницы: Постдок: теоретическая физика высоких энергий. Студенческий форум Физфака МГУ > Общий > Работа . ... Theoretical Particle Physics . ... The high energy theory group at Wayne State University (http://www.physics.wayne.edu/~apetrov/particle_nuclear/) anticipates making one postdoctoral research appointment to start September 1, 2007 or earlier. ... Department of Physics and Astronomy . ...

Еще в разделе: (Показать все результаты (>191) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > PhD positions in Switzerland
• Студенческий форум Физфака МГУ > Форум "Всемирный год физики в МГУ"
• Студенческий форум Физфака МГУ > Greate opportunity in u life ! Going global

... 9) Oknyanskij V.L. 1994, "Optical-radio time delays in Q0957+561", Odessa Astronomical Publ., ... 11) Oknyanskij V.L. 1994, "Connection between X-ray and optical variability in NGC4151", in Proceedings of Int. Conf. ... 1994. 12) Oknyanskij V.L. 1994, "Connection between X-ray and optical variability in NGC4151", Astrophys. and Space Science, 222, p.157. ... 14) Oknyanskij V.L., van Groningen E., 1997, "Optical spectral variability of NGC4151 in 1990", Astronomical and Astrophys. ...

Еще в разделе: (Показать все результаты (>12) - uranus.sai.msu.ru/ )

organic papers Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 4-Methyl-1-(3-nitrophenacyl)-5,6,7,8-tetrahydroquinolin-2(1H)-one Dmitry V. Albov,* Victor B. Rybakov, Eugene V. Babaev and Leonid A. Aslanov Department of Chemistry, Moscow State University, 119992 Moscow, Russian Federation Correspondence e-mail: albov@struct.chem.msu.ru In the pyridone ring of the title compound, C18H18N2O4, single and double bonds alternate, showing some degree of conjugation. ... Acta Cryst. ...

Еще в разделе: (Показать все результаты (>87) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/034e.pdf

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>26) - hsmi.msu.ru/ )

• News | MSU Higher school of management and innovation

... Ganin I.P., Kaplan A.Ya. ... Ganin I.P., Shishkin S.L., Kaplan A.Y. A P300-based brain-computer interface with stimuli on moving objects: four-session single-trial and triple-trial tests with a game-like task design. ... Kaplan A.Y., Shishkin S.L., Ganin I.P., Zhigalov A.Y. Adapting the P300-based brain-computer interface for gaming: a review. ... Shishkin S.L., Ganin I.P., Basyul I.A., Zhigalov A.Y., Kaplan A.Y. [P300-based brain-computer interface: the N1 wave and the distractor problem.] ...

Еще в разделе: (Показать все результаты (>29) - brain.bio.msu.ru/ )

• S.Borisov
• 'Московский ИМК' - исследования по интерфейсу мозг-компьютер (управление "силой

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>2) - unesco.fgp.msu.ru/ )

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>16) - curl.sai.msu.ru/ )

... Географии мирового хозяйства . ... Конференции, семинары, совещания . ... Добавлено 03 .02.2016 . ... Тезисы докладов принимаются до 1 декабря 2015 г. Добавлено 18 .03.2016 . ... Abstract submission deadline is 13 January 2016. ... Заявки на участие в конференции принимаются до 11 марта 2016 г., тезисы докладов до 21 марта 2016 г. Первый циркуляр . ... Fourth PAST Gateways (Palaeo-Arctic Spatial and Temporal Gateways) International Conference, 23-27 May 2016 , Trondheim, Norway. ...

Еще в разделе: (Показать все результаты (>327) - www.geogr.msu.ru/ )

• Информационные ресурсы
• culmination fashion of in defiance of a mode ugg boots on purchasing like on
• kdsuous|ellakpi kdsdylu|ellahipJH (все сообщения)

... GeneBee . ... Courses in Bioinformatics . ... What is GCG? ... Usage of GCG Package on GeneBee Server . ... What is WhatIf? ... Computer Class . ... Due to colaborate work of many laboratories the total length of published nucleotide sequences is now . ... GCG vs. ... Usage of GCG Package on GeneBee server . ... Computer class . ... Computer class is used for bioinformatic courses and for scientific semenars. ... Everyone who need a consultation for GeneBee service, GCG or WhatIf package is welcomed...

Еще в разделе: (Показать все результаты (>125) - www.genebee.msu.ru/ )

• Impact Factors of Scientific Journals in 1999

... Pyrococcus furios (14506) [f] 149 41.9 3.6e-05 AE010241 AE009950 |AE010241| ... Pyrococcus furiosus DSM 3 (14506 nt) initn: 141 init1: 116 opt : 149 Z-score: 163.3 bits : 41.9 E(): 3.6e-05 banded Smith-Waterman score: 149; 78.8% identity (78.8% similar) in 52 nt overlap (19-69:9586-9637) 10 20 30 40 U00096 TGGTGCTGATACCCAGAGTCGAACTGGGGACCTCACCCTTACCAAGGG : :::: ::::::: : ::::::::: : AE0102 TTATTAAAAACATGGAGCCCCGGCCGGGCTTTGAACCCGGGACCTGCCGCTTACCAAGCG 9560 9570 9580 9590 9600 9610 50 60...

Еще в разделе: (Показать все результаты (>308) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/FBB/Moscow-advert.doc
• http://kodomo.cmm.msu.ru/~nihilenia/term2/B.msf
• http://kodomo.cmm.msu.ru/~nihilenia/term2/Q2YUW6_STAAB.msf

... Place: Moscow State University (MSU), Universitetskii pr-t, 13, Moscow. ... SAI, Moscow ), Hanada H. (NAO, Mizusawa), Petrova N. (KSU, Kazan ), Zotov L. (SAI, Moscow ) Program of RJLPC Session I. The Moon : Kaguya mission Chair Barkin Yu.V. 10.00 - 10.30 H. Hanada (1), RISE team, RSAT/VRAD team, ILOM team (1) RISE Project, National Astronomical Observatory, Mizusawa, Oshu, Iwate, Japan The present status of KAGUYA (SELENE) and ILOM in RISE project 10.30 - 11.00 Matsumoto K. National ...

Еще в разделе: (Показать все результаты (>64) - sai.msu.ru/ )

• Конференции сайта АстрО

NANO AND GIGA CHALLENGES IN MICROELECTRONICS: RESEARCH OPPORTUNITIES IN RUSSIA . ... Moscow, September 11-13, 2002 . This meeting will bring together scientists and engineers from academia, industry and national labs to discuss recent developments, and explore potential for collaboration solving the most challenging scientific and engineering problems in microelectronics. ... atomic scale design: theory and experiment . highest frequency electronics . ... non-silicon materials and devices . ...

Еще в разделе: (Показать все результаты (>26) - genphys.phys.msu.su/ )

Studia Baltica II « : » , 10-16 2012 Studia Baltica II International Youth Summer School «Baltic region: historical memory and dialogue of cultures» Kaliningrad, Russia 10-16 September, 2012 . 10-16 2012 . II Studia Baltica « : ». ... 1. (3-5) , , , (, , , , ) 30 . ... http://www.kantiana.ru/international/announcements/application_sb2_2012.docx); ( ­ ) ; / /, / ( ). Studia Baltica 2012 ( 800 ). Studia Baltica 2012 Studia Baltica 2011 ( ), . ...

Еще в разделе: (Показать все результаты (>10) - polit.msu.ru/ )

The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...

117. Bach suite

118. http://hbar.phys.msu.ru/hbar/pages/stefan/index.html

119. Клуб выпускников МГУ: Хотите жить дольше? 3 основных секрета

120. About authors ot this complex