... Moscow State University, Sternberg Astronomical Institute . ... Moscow State University, Sternberg Astronomical Institute, Cremian Laboratory . Dr. Vladimir Amirhanyan - Soft, Radioobservations, Interpretations . Sternberg Astronomical Institute . Aleksandr Belinskiy - mechanics, soft, observations, interpretation . ... Mikhaylo Kuznecov - mechanics, soft, observations, interpretation . ... Moscow State University, Physics Department . ... Gleb Antipov - observations, interpretation . ...

Еще в разделе: (Показать все результаты (>40) - observ.pereplet.ru/ )

• MASTER
• MASTER ROBOTIC TELESCOPES NET

... BRAHMS, PHENIX, PHOBOS STAR. ... TPC, SVT, FTPC, EMC. TPC (Time Projection Chamber) STAR ґ - (TPC), . ... SVT , TPC. ... STAR Argonne National Laboratory, Argonne, Illinois 60439, USA Brookhaven National Laboratory, Upton, New York 11973, USA University of California , Berkeley, California 94720, USA University of California , Davis, California 95616, USA University of California , Los Angeles, California 90095, USA Universidade Estadual de Campinas, Sao Paulo, Brazil ...

Еще в разделе: (Показать все результаты (>216) - nuclphys.sinp.msu.ru/ )

• The World-Wide Web Virtual Library: Nuclear Physics
• Staff of General Nuclear Physics Division
• The Columbia University, 1960 Left to right: S.A.Azimov, A.M.Baldin,

Russian] . The Geophysical department at MSU Geological faculty . The laboratory of near-surface electrical prospecting . ... TES technology for 2D resistivity sounding data processing, visualization and interpretation (unpublished article). ... Resistivity sounding ( in Russian ) . ... IPI2win & IPI_res3 (Windows) ver. 3.0.1a; 7-Jan-2003 . TRF_2D (Windows) [in English and in Russian] . ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics. ...

Еще в разделе: (Показать все результаты (>88) - geophys.geol.msu.ru/ )

• Links of engineering geophysics and software
• Geophysical department at Moscow University
• TES tecnology. MSU.

Welcome to the site of the Laboratory of Mathematical Models of Quantum Scattering Processes . ... It develops mathematical models of ionizing collisions in atomic, molecular, and condensed matter physics. Main areas of current research activity include single and multiple ionization by electron, ion, and photon impact, ionization processes in strong laser pulses, and laser-assisted ionizing collisions. ... Research | ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>15) - lmmqsp.sinp.msu.ru/ )

... research . ... I'm a postdoc in the group of Mathematical Modelling , Institute for Chemistry and Biology of the Marine Environment (ICBM), . University of Oldenburg, 26129 Oldenburg, Germany . ... a.ryabov@icbm.de . ... Research Associate . ... Nonlinear Dynamics Group . ... Nonlinear Dynamics & Chaos Group . Moscow State University . ... Ph.D. in Nonlinear Dynamics, Moscow State University . ... Diploma work in Statistical Physics, Moscow State University . ... б?2009 Ryabov Alexey | ...

Еще в разделе: (Показать все результаты (>100) - chaos.phys.msu.ru/ )

• Staff

... Н айти друзей по учебе, договориться о встрече группы или курса, рассказать о себе и своей работе, разместить информацию о своей организации, поздравить соседа по университетской парте с днем рождения, обсудить общие проблемы - все это можно сделать в Клубе выпускников. ... З десь Вы можете найти информацию о любом зарегистрированном выпускнике МГУ, а также обновить информацию о себе или о тех, чей пароль Вы знаете. ... Экономический, 1999 . Биологический, 1999 . Биологический, 1986 . ...

Еще в разделе: (Показать все результаты (>2) - new.guru.ru/ )

... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...

Еще в разделе: (Показать все результаты (>4) - newcryst.phys.msu.ru/ )

... 2015 . ... Submit your article . ... Ph.D., associate professor, Petrozavodsk State University. ... This article is a continuation of author s research in the sphere of modernizations of timber industry of Karelia in the XX century. This article is devoted to the analysis of the State s role in post-Soviet transformation of social institutes important for modernization of timber industry, such as the institute of ownership of timber resources or labor relations. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>570) - ee-journal.spa.msu.ru/ )

... Meeting with the representatives of Russian Universities took place on July 4 2014. ... During the meeting many ways of involvement of entrants to engineering faculties were discussed. Participants agree that the most acceptable alternative is the realization of engineering research projects and contests among the schoolchildrens. Sergey Elizarov makes presentation about engineering physics on Faculty of Physics of Moscow State University. Presentation . ...

Еще в разделе: (Показать все результаты (>55) - engineering.phys.msu.ru/ )

• X Congress of Russian Rectors Union

... ACAT'2003 : IX INTERNATIONAL WORKSHOP ON ADVANCED COMPUTING AND ANALYSIS TECHNIQUES IN PHYSICS RESEARCH (ACAT03), 1-5 December, 2003, Tsukuba, Japan. ... Advanced Statistical Methods for Data Analysis Traditionally, researchers from high energy and nuclear physics together with experts in computer science take part in the ACAT series of workshops. ... Thus, researchers from these and other fields are welcome to join us in discussions on modern computing techniques and ways for new developments. ...

Еще в разделе: (Показать все результаты (>72) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-01-Introduction1.pdf
• http://acat02.sinp.msu.ru/hp-grants.html
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-05-Communication1.pdf

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>12) - www.law.msu.ru/ )

INTERNATIONAL CONFERENCE HYDRODYNAMIC INSTABILITY AND TURBULENCE February 26 - March 05, Moscow, Russia ORGANIZED by Moscow State University, Institute of Mechanics of MSU and Faculty of Mechanics and Mathematics. ... SPONSORED by Russian Foundation for Basic Research, Moscow State University, Institute of Mechanics of MSU. ... Prospective participants must send abstracts in Word to the Organizing Committee (gertsens@imec.msu.ru) not later than 15 January 2006. ... Phone, E-mail and Fax number. ...

Еще в разделе: (Показать все результаты (>33) - hit-conf.imec.msu.ru/ )

• Moscow 2006
• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled

... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...

Еще в разделе: (Показать все результаты (>6) - www.moip.msu.ru/ )

... UHECR SINP MSU . ... TUS . ... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . ... For students . Our students . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... JEM-EUSO is a new type of observatory that uses the earth's atmosphere as a detector. ...

Еще в разделе: (Показать все результаты (>16) - uhecr.sinp.msu.ru/ )

• Scientific relations

Magna Charta Universitatum Bologna, Italy September 18, 1988 PREAMBLE The undersigned Rectors of European Universities , gathered in B ologna for the ninth centenary of the oldest University in Europe, four years before the definitive abolition of boundaries between the countries of the European C ommunity; looking forward to far-reaching co-operation between all European natio ns and believing that peoples and States should become more than ever aware of t he part that ...

Еще в разделе: (Показать все результаты (>97) - www.socio.msu.ru/ )

• Вестник МГУ
• English version - Социологический факультет МГУ

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>13) - discours.philol.msu.ru/ )

• Tatiana Venediktova
• Anna Kotomina
• About

MGU Botanic Garden . ... The MSU Botanical Garden is not only a valuable scientific institution, but also a place giving joy and a good mood to many people. ... To become a volunteer, please, fill in the application e-form and send it to the following e-mail address: . ... We will contact you on your telephone number within a week of your sending the application. Community work days are also held on the territory of the Garden for different organization and agency workers. ...

Еще в разделе: (Показать все результаты (>18) - botsad.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Gas Sensors Laboratory (SENSOR) , Department of Chemistry and Physics for Engineering and for Materials , University of Brescia , Italy: Prof. Giorgio Sberveglieri, Guido Faglia, Maurizio Artoni, Camilla Baratto, Dario Zappa. Lab contact Prof. Alexander Gaskov. ... Laboratory contact person: Dr. S.G. Dorofeev . ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>60) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials

GROUP ALUMNI . ... Moscow . ... Kazakh-British Technical University , Almaty . ... USA Now works with Prof N.P. Kuzmina on our division MSU . Serov T.V. Russian Research Centre Kurchatov Institute , . ... Russia . ... Shabalin D.G. Moscow Institute of Mechanics Lomonosov Moscow State University Russia . ... Dr. Prituzhalov V.A. Moscow Russian Corporation of Nanotechnologies (RUSNANO) Russia . ... Moscow Russia . ... E gorova B airta .V ladimirovna 2006-2011 . Urmanov Artur V. 2007-20011 . ...

Еще в разделе: (Показать все результаты (>110) - www.inorg.chem.msu.ru/ )

• Inorganic Synthesis Laboratory people
• Joint Semiconductors Surface Study group
• Group of Hydrothermal Synthesis :: Bulat R. Churagulov

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search