ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...

Еще в разделе: (Показать все результаты (>14) - oc.cs.msu.ru/ )

... Магистерское образование . ... Магистерские программы . ... Магистерские программы (учебные планы) . ... Introduction to Cryptography . ... Basic requirements for data security in software systems. ... Lecturer: associate professor Primenko E. A. Mathematical Theory of Information . ... Addition operation of elliptic curve's points. f Postnikov's theorem.Theorems on the order of elliptic curve for certain types of primes. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>23) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское
• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> Building a Building . Пользователи . Демо . Деньги . Фильмы . Форум . Building a Building . США 1933 . отметить . Мультфильм . Мелодрама . Комедия . Семейный .

Еще в разделе: (Показать все результаты (>210) - kinfo.ru/ )

• Elvis Has Left the Building - Фильмы - Kinfo.ru
• Building the Bad House: Maki.. - Фильмы - Kinfo.ru
• The Empty Building - Фильмы - Kinfo.ru

RIDGE AND TREE FEATURE DETECTION ON IMAGES A. Levashov 2, D. Yurin3 2, 3 1 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia 2 alexeylevashov89@gmail.com , 3yurin@cs.msu.ru In this article a new ridge detector with improved non-maxima suppression procedure in scale-space is proposed. ... The algorithm is tested on synthetic, landscape and medical images. ...

Еще в разделе: (Показать все результаты (>21) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/files/courses/ipintro2012/Lec_Pt1_Color_photo.pdf

pic] [pic] PARTNERSHIP AGREEMENT between the Russian Rectors' Union and the Russia Machine Builders' Union The Russian Rectors' Union (RRU) and the Russian Machine Builders' Union (RMBU), hereinafter referred to as The Parties Confirming the importance of the further development and strengthening of partnership relations between the scientific-educational ...

Еще в разделе: (Показать все результаты (>27) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/328.doc

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>20) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011_en.pdf

... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....

Еще в разделе: (Показать все результаты (>8) - angel.cmc.msu.ru/ )

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>81) - textbook.sinp.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of colloidal quantum dots on InP based biomarkers to create . ... For this it is necessary to carry out the replacement of stabilizing shells . ... To replace the membranes using standard samples CT InP, MA stabilized , since the latter is quite labile ligand , as well as samples of heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ...

Еще в разделе: (Показать все результаты (>32) - www.lssm.inorg.chem.msu.ru/ )

Title Author Key words The problem of integration of ethnic migrants in the Russian Far East and its features in Sakhalin region Konkov A.T. Russian Far East, ethnic migration, interethnic relationships, interethnic tension, integration and adaptation of ethnic migrants Foreign migration to the Russian Far East is a comparatively new phenomenon; however within the period of the last 20 years there have emerged certain problems of interaction between ethnic migrants and the receiving society. ...

Еще в разделе: (Показать все результаты (>92) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/06.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/4/09.pdf
• Вестник МГУ

Evolution of the double neutron star merging rate and the cosmological origin of Gamma-ray burst sources " , Astroph.J., 1995, v.454, 593-596 (Lipunov, V.M. Postnov, K.A. and Prokhorov M.E.) . Evolution of SupernovaЃExplosion Rates in theЃ Universe (Jorgensen H., Lipunov.M., Panchenko I.E., Postnov K.A., Prokhorov M.E.) ApJ, 1997, v.486,p.110 . ... Formation of a Gravitationally Bound Object after Binary Neutron Star Merging and GRB phenomena " (G.V.Lipunova, V.M.Lipunov). ...

Еще в разделе: (Показать все результаты (>17) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>29) - mailybaev.imec.msu.ru/ )

... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• BDRG | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"
• ELFIN-L | Университетский спутник "Ломоносов"

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>21) - www.rochesterastronomy.org/ )

... Географии мирового хозяйства . ... Выберите кафедру . ... Кафедры . ... Key words: evolution problems of geography, the Brownian motion, glaciers, lakes, palaeoclimate, uneven rotation of the earth, anomalies of temperature and salinity. ... Alexeenko N.A. Maps of nature management conflicts for the design of nature protection areas of regional and local importance . ... Key words: design of nature protection areas, nature management conflicts. ... Key words: regional nature management, Dagestan . ...

Еще в разделе: (Показать все результаты (>284) - www.geogr.msu.ru/ )

• CONTENTS ? 5 - 2013
• CONTENTS ? 4 - 2013
• CONTENTS ?6 - 2011