... about ERC . education . research . ... The Lomonosov Moscow State University (MSU) has been training specialists in nanotechnology, nanomaterials and nanosystems for nearly ten years . ... MSU Nanotechnology Education and Research Center (ERC) was established to consolidate efforts of MSU units aimed at research and development and true cross-disciplinary education in nanotechnology, nanomaterials and nanosystems. ... Fundamentals of Nanotechnology? was the first step in ERC?s activity. ...

Еще в разделе: (Показать все результаты (>33) - nano.msu.ru/ )

• Announcement about the admission to MSU Graduate School for a new Master?s

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>50) - rswater.phys.msu.ru/ )

• Group of laser spectroscopy of solutions of supramolecular compounds and

Mishchenko Alexandr S. was born 18.08.1941, Rostov-Don. He has graduated the Department of Mathematics and Mechanics of Moscow State University (1965). ... Professor of the Chair of higher geometry and topology of the Department of Mathematics and Mechanics of MSU (1979). Leading researcher of the Steklov mathematical institute of RAS. ... Leader of Moscow scientific school on non commutative geometry and topology. Area of scientific interest: geometry and topology and their applications. ...

Еще в разделе: (Показать все результаты (>178) - higeom.math.msu.su/ )

• Alexey Garber
• Conferences (English)
• Publications (English)

Studying at MU Programs and degrees . ... Moscow State University provides a wide range educational services and educational programmes. ... International students are offered Bachelour (4 years full time) and Master programmes (2 years full time). A number of our faculties train both domestic and international students according to Bachelour and Master programmes with granting Bachelour and Master diplomas. ... Please, contact International Students Office for information on the topics offered. ...

Еще в разделе: (Показать все результаты (>23) - www.ied.msu.ru/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>5) - composite.msu.ru/ )

• Department of the Composites Mechanics

... ВШБ МГУ - школе . ... В газете The Northeastern Voice (Northeastern University) вышла статья про стажировку студентов Высшей школы бизнеса МГУ в Бостоне. ... Puffer and McCarthy, who have worked for years with Moscow State University faculty, said MSU professor Alexander Naumov who has also taught at Northeastern, and who coauthored a book with Puffer proposed the program earlier in the year. ...

Еще в разделе: (Показать все результаты (>1557) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова
• Выпуск 1/2012 | Высшая школа бизнеса МГУ им. Ломоносова

... Вниманию аспирантов! ... Вниманию аспирантов (группа проф. Хмелевской С.А.)! Семинар по истории и философии науки 30 марта отменяется. ... Вниманию аспирантов первого года обучения! ... Лекции по истории и философии науки будут читать проф. Яковлев В.А. по пятницам в 12:30, ауд. 5-18 (первое занятие 18 марта) и проф. Волкогонова О.Д. по понедельникам в 15:20, СФА (первое занятие 14 марта). ... Семинары по истории и философии науки будут проходить по вторникам в 17:00, ауд. ... Вниманию аспрантов! ...

Еще в разделе: (Показать все результаты (>2) - aspirant.phys.msu.ru/ )

... For 1st and 2nd-year students . Introduction to quantum physics . ... 2nd-year course work topics . ... Leading Researcher . Senior Researcher . ... Research Associate . 7(495)939-4372 (4) . ... The Laboratory performs research activity in the following directions: . Quantum optics of biphoton fields . Quantum optics of pulsed fields . ... Terahertz generation and detection . ... Quantum photometry in the terahertz range . ... 2003 2016 Department of Quantum Electronics . ...

Еще в разделе: (Показать все результаты (>46) - quantum.phys.msu.ru/ )

• People | Department of Quantum Electronics
• Theory | Department of Quantum Electronics
• Elyutin Pavel | Department of Quantum Electronics

... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). ... ASMS was founded in 1969 and, as of 2008, has approximately 7000 members, working on scientific reseach and development in mass spectrometry methods and instruments. ... The 56th ASMS Conference on Mass Spectrometry lasted five days. ... FT-ICR mass spectrometry ....

Еще в разделе: (Показать все результаты (>11) - ani.cs.msu.su/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )

• "Advanced Methods in Validation and Identification of Nonlinear Constitutive

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>30) - dynamo.geol.msu.ru/ )

• Professional experience of V.Zakharov
• Textbooks - Dynamic Processes in Geology

Search: . Word Search . ... All alternatives . Papers: . EDAS (submitted) . Other Papers . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS2 - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

PHP Manual . ... If you are still stuck, someone on the PHP installation mailing list may be able to help you. ... If you want to get help on the mailing list, please try to be precise and give the necessary details about your environment (which operating system, what PHP version, what web server, if you are running PHP as CGI or a server module, etc.), and preferably enough code to make others able to reproduce and test your problem. If you think you have found a bug in PHP, please report it. ...

Еще в разделе: (Показать все результаты (>465) - oit.cmc.msu.ru/ )

• testparm (1)
• Starting Apache
• Environment Variables in Apache

... The Noether's Integrals in Optimal Problems of Hypersonic Aerodynamics . ... The heat transfer on the hypersonic aircraft surfaces can be investigated in the limits of boundary layer theory. Majority of works on the theory of optimal controlled boundary layer is connected with the control of incompressible liquid movement, the problems of compressible viscous gas optimal control are considered in a small number of publications. ...

Еще в разделе: (Показать все результаты (>478) - acs366.phys.msu.su/ )

• Abstract (Invited)
• AUTHOR : Ibragimov N
• Nonlinear Acoustics and Optics

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Economic Department | ECFS
• Online Consultation on Network and Partnerships in the area of Food Security |
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS

... Scientific conference . ... International recognition of this outstanding woman and scientist serves as a wonderful example for the young people who have chosen chemistry as the basis for the carrier, and makes it possible to commemorate the important contribution of women in the development of chemistry as a science.  ... Especially in Russia women received possibility of professional realization in chemical science and education through  different ways starting from 1870’s on. ...

Еще в разделе: (Показать все результаты (>157) - www.chem.msu.ru/ )

• CURRICULUM VITAE

... TernAPI program . ... TernAPI program is designed for ternapy phase diagrams calculation by means of the convex hull method. ... Quick calculation of isobaric-isothermal sections of ternary systems phase diagrams (1-30 sec.) ... Voskov A.L., Dzuban A.V., Maksimov A.V. TernAPI program for ternary phase diagrams with isolated miscibility gaps calculation by the convex hull method // Fluid Phase Equilib . ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Laboratory of Chemical Thermodynamics
• Colloquium on 18.05.09 Laboratory of Chemical Thermodynamics
• Colloquium on 05.11.09 Laboratory of Chemical Thermodynamics

... California Department of Education (1985), Mathematics framework for public schools, kindergarten through grade twelve. ... California Department of Education (1992), Mathematics framework for California public schools, kindergarten through grade twelve. ... California Department of Education (February 5, 1998), The California mathematics academic content standards. [ http://www.cde.ca.gov/board.html ] . ... NCTM (1998), California mathematics academic content standarts for grades K-12. ...

Еще в разделе: (Показать все результаты (>823) - www.nature.web.ru/ )

GMATCH . That projects is aimed for the solution of the well known problem of all observational astronomers -- the WCS alignement of the images. It is always great to have the possibility to determine the exact J2000 coordinates of each point of the frame. It is always great to not manually align the images before summing them. My program is aimed to solve all those problems. ... Download . ... WCSLIB library (by M. Calabretta)(download from here ) . ...

Еще в разделе: (Показать все результаты (>310) - lnfm1.sai.msu.ru/ )

• Труды Ширмина Г.И.
• Scientific activity
• Problems