Radiation Physics and Chemistry 61 (2001) 241246 Radiation in archaeometry: archaeological dating Marco Martini*, Emanuela Sibilia " INFM and Dipartimento di Scienza dei Materiali, dell' Universita degli Studi di Milano, Bicocca, via R. Cozzi 53, 20133 Milan, Italy Abstract Crystalline inclusions contained in ceramics act as thermoluminescent dosimeters, the irradiation source being the natural radiation environment. ... Keywords: Thermoluminescence; Dosimetry; Ceramics; Archaeological dating 1. ...
... Данный раздел информационного портала посвящен основным конференциям по тематике ПЛИС, проходящим как в мире, так и в России. FPGA 2010 - Eighteenth ACM/SIGDA International Symposium on Field-Programmable Gate Arrays. ReConFig'09 - 2009 International Conference on ReConFigurable Computing and FPGAs. ИКТМР-2009 . ... 2009 Symposium on Application Accelerators in High-Performance Computing (SAAHPC'09) . RAW 2009 . ... 5th International Workshop on Applied Reconfigurable Computing. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... ОБЩИЕ СВЕДЕНИЯ О СЕТИ ИНТЕРНЕТ . ... Краткая история развития сети . История Интернет уходит своими корнями в ранний период развития компьютеров и компьютерных сетей. ... Осуществление таких жестких требований на практике стало возможным только путем использования уже существовавших компьютерных сетей. ... Но в сети Интернет возможно осуществить и более сложный режим пересылки информации с удаленного компьютера, получивший название протокола FTP (File Transfer Protocol). ...
... Photos and pictures at Archives.gov . ... Escher Art Collection . ... International Art Science . ... Earth Observatory image news index . ... Moscow: administration, culture, education.. ... Fluid Dynamics Pictures of the Week Collection . Sites With Pictures and Movies of Fluids also you can look at the interesting High-Speed Photographs . ... Moscow day by day . ... old maps of Moscow . ... Crimea . Crimea MAP (clickable) . Surfing Santa Cruz . On-line pictures: . ...
... Lomonosov Moscow State University . ... Home About Communication and Information Department . ... Our main areas of expertise are information exchange, building network partnerships, development of complex internet applications and solutions, implementing e-learning practices.б . ... Dr. of Science (biology) Alexander O. Makeev Graduated from Geographic Faculty of Lomonosov Moscow State University. ... Alexander Ladygin graduated from department of Biology of Lomonosov Moscow State University. ...
... About Us . ... The Department of Spanish Language . ... According to the information stated above, Spanish language department students are trained in the following areas: . ... Also, the Department of Spanish Language is the only department where detailed studying of Spanish language peculiarities and linguistic ethnical consciousness in Spain and Latin America are provided, thanks to specialized courses and seminars, apart from language studying, at a student's choice during 8 semesters. ...
... Practical courses . ... The architecture of data acquisition and control systems systems and laboratory works employs various types of plug-in boards, CAMAC modules, GPIB boards, original connecting cards and virtual generators, breadboard modules, and sound blasters, which are used as generators of analog signals of different shapes and as analog-to-digital converters. ... Pascal and C++ are employed to program the different blocks of data acquisition and control systems systems. ...
... Если вы заинтересованы участвовать в работе Симпозиума, мы просим вас направить по электронной почте в адрес Оргкомитета (motility2006@iteb.ru) заполненные регистрационные формы до 1 февраля 2006 года и направить ваши тезисы до 15 марта 2006 года. ... Тезисы должны быть присланы по электронной почте вложенным файлом (предпочтительно) по адресу motility2006@iteb.ru или на дискете по адресу 142290, Институт теоретической и экспериментальной биофизики РАН, г. Пущино, Московской обл., ...
Diploma thesis abstract «Multi-channel time-to-digital converter in quantum cryptography» Author: Turaev Maxim Alexandrovich Scientific adviser : Magnitsky Sergey Alexandrovich Yakovlev Dmitry Vladimirovich Scientific co-adviser: The present work is devoted to the time measuring system (Time-to-Digital Converter) with picosecond accuracy. Particular attention is paid to the application of that system in the private key generation problem in quantum cryptography. ...
[
Текст
]
Ссылки http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2016/Turaev_Yakovlev_Magnitsky_en.pdf -- 345.2 Кб -- 23.12.2015 Похожие документы
The subject of cybernetics is quickly growing and there now exists a vast amount of information on all aspects of this broad-based set of disciplines. ... The fields of application are virtually unlimited and applications are discovered in the investigation or modelling of any complex system. The most obvious applications have been in the construction of artificially intelligent systems, the brain and nervous system, and socio-economic systems. ...
ВМиК-Online! ... С 16 февраля по 4 мая на факультете вычислительной математики и кибернетики (ВМиК) МГУ пройдет специализированный курс для студентов по технологиям универсальных вычислений (GPGPU) на графических процессорах nVidia с использованией API CUDA*. ... Открытые лекции по технологии CUDA будут читаться на факультете ВМиК МГУ в аудитории 685 второго учебного корпуса Московского университета. ... Отметим, что данный учебный курс будет читаться на факультете ВМиК МГУ уже во второй раз. ...
SIDA training in Sweden . Arthur R.Lyandzberg, Inna A.Novikova 22 февраля 2002 00:17:15 . ... Sida Country info Sector info Publications Training Programmes . ... Environment . Local Environment Management . ... Land Administration Geographical . ... Urban Land Management . ... Integrated Water Resources Management . ... Operational Hydrology, Technology Management . ... Contents:Hydrological problems, water management and general hydrology . Authorities, legislation and policies . ...
... Academic Departments . ... Partners . ... All partners . ... 05.04.2013 On March 29 Professor Robert Weisbrot (Colby College, USA) delivered a lecture at the Faculty of Journalism, Lomonosov Moscow State University. ... The lecture was part of the exchange program between Faculty of Journalism, MSU and Colby College. Earlier in March Associate Professor at the Faculty of Journalism, Dr. Mikhail Makeenko lectured on the topic "Censorship and the Media in Putin s Russia" at Colby . ...