Next: How is Mail Delivered? ... A Mail message generally consists of a message body, which is the text the sender wrote, and special data specifying recipients, transport medium, etc., very much like what you see when you look at a letter's envelope. ... The second variety is any data necessary for handling the mail message, which is not particular to any transport mechanism, such as the message's subject line, a list of all recipients, and the date the message was sent. ... This field is optional. ...

Еще в разделе: (Показать все результаты (>118) - itpm.msu.su/ )

• mod_expires - Apache HTTP Server
• HTML and URLs
• Pathalias and Map File Format

... Brykina I. G. Methods for calculation of heat transfer and skin friction in 3D hypersonic laminar flow over bodies at all Reynolds numbers. ... Sakharov V. I. Simulation of nonequilibrium viscous gas flows in induction plasmatrons and over bodies. ... Shcherbak V. G. Numerical study of nonequilibrium air flow over bodies. ... Tirskiy G. A. Destruction of solid bodies in the hypersonic gas flow. ... Rusakov V. V. Analytical and numerical investigation of 3D viscous flow over blunt bodies. ...

Еще в разделе: (Показать все результаты (>7) - lab106.imec.msu.ru/ )

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>13) - io.cmc.msu.ru/ )

Google as a taxonomic engine Alexey Shipunov Background: tree cow mouse rat Background: Google Scholar · · · · · · · Extract phyla names Obtain numbers of joint hits Do some magic Calculate similarity Make clusters Same, with - ecology Same, with classes names Numbers of joint hits · · · · · Phyla names from my synat classification R script to ...

Еще в разделе: (Показать все результаты (>82) - herba.msu.ru/ )

• http://herba.msu.ru/shipunov/school/biol_240/data/nanodrop_c.txt
• New Page 1

... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker­Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation-propagation directions. The coefficient of angle diffusion is calculated using the Mie theory. The equation is solved numerically using the stochastic analog method, and the space and angle distribution of the radiation that passed through the diffuser is calculated. ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/rec-GaN.pdf
• http://lizard.phys.msu.su/home/science/rec-GaN.ps.gz
• http://lizard.phys.msu.su/home/science/Dmitriev-Tkaceva-14-JElectMat-PbTe.pdf

... GOTO 100 0038 IF(ALFA.EQ.0.) ... EPS)GOTO 2 0054 IF(ALFA.EQ.0.) ... GOTO 68 0075 K2=K2+1 0076 IF(K2.EQ.IMAX) GOTO 67 0077 X0=Y 0078 F0= AN4 0079 GOTO 23 0080 37 CONTINUE C * changing the interval 0081 X=Y 0082 F= AN4 0083 GOTO 23 0084 ENTRY PTIPRE C * entry to continue calculations 0085 ICONT=1 0086 GOTO 110 0087 64 CONTINUE C * working array is too short 0088 IERR =64 0089 GOTO 9999 0090 65 CONTINUE C * initial regularization parameter is too small 0091 IERR =65 0092 ...

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

• http://foroff.phys.msu.ru/phys/med/engl_ver/evc_02ft.pdf
• http://foroff.phys.msu.ru/illposed/programs/Listing_01.txt
• Faculty of Physics today

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>23) - cryst.geol.msu.ru/ )

Windows CP1251 . Dynamic of crust thickness under collision (from the modeling). при коллизии. Deformation of a crust, calculated from model taking into account erosion and sedimentation and elastic properties of undercrust lithosphere. Velocities of viscous flow in in lower crust (from the modeling). Thermal history of collision zone (from the modeling). Differences with the "normal" temperature field in collision zone (from modeling). Page design: їV.Zakharov . ...

Еще в разделе: (Показать все результаты (>19) - dynamo.geol.msu.ru/ )

• Доклады В.С.Захарова
• V.Zakharov's Ph.D. thesis

... Time calculated from Fermi GBM Trigger Time = 14:12:08.67 ( Connaughton, GCN 9230 ). 1% coincident with our start zero image time. 3x3 degrees around Swift XRT position . ... SUBJECT: GRB 090424 : MASTER-Net prompt optical limit DATE: 09/04/25 20:29:42 GMT FROM: Vladimir Lipunov at Moscow State U/Krylov Obs E. Gorbovskoy, V. Lipunov, V.Kornilov, A.Belinski ... Our observations results: ---------------------------------------------------------------------- Fermi GRB Trigg.* ...

Еще в разделе: (Показать все результаты (>12) - observ.pereplet.ru/ )

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

Wavelet Analysis of E852 Experimental Data V. L. Korotkikh  and L. I. Sarycheva   Scobeltsyn Institute of Nuclear Physics, Moscow State University, Moscou 119899, Russia Abstract. A calculation of background in the hp 0 mass spectrum by the wavelet analysis is presented. ... A large final state statistics of E852 experiment [4, 5, 6] in the p p interactions at 18 GeV/c allows to use the wavelet analysis both for one­dimensional and for two­ dimensional distributions. ... are built (fig. ...

Еще в разделе: (Показать все результаты (>40) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/pp_coll_ppt_16May_report.pdf
• http://lav01.sinp.msu.ru/nir/papers/IEEE_TNS_52_3_2005_741-744.pdf

... Сотрудники . Ларин Александр Владимирович . ... Larin A.V., Leherte L., Vercauteren D.P. Approximation of the Mulliken-type charges for the oxygen atoms of all-siliceous zeolites // Chemical Physics Letters. ... Larin A.V., Parbuzin V.S.,Vercauteren D.P., Cumulative coordinate technique for approximation of high atomic multipole moments of aluminophosphate sieves on the basis of electron densities calculated with DFT methods, Int. J. Quantum Chem., ... Chem. ... Chem.Phys . ... Russ.J.Phys.Chem . ...

Еще в разделе: (Показать все результаты (>20) - beams.chem.msu.ru/ )

... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...

Еще в разделе: (Показать все результаты (>10) - lomonosov.sinp.msu.ru/ )

• ShOK | Университетский спутник "Ломоносов"

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• StructAlign help

arxiv:1008.3999 Наблюдения космических электронов на Fermi LAT на энергиях от 7 ГэВ до 1 ТэВ (Fermi LAT observations of cosmic-ray electrons from 7 GeV to 1 TeV) . Authors: Fermi LAT collaboration . ... Authors: Andrey E. Vladimirov et al. обзор arxiv:1008.5032 Релятивистская прецессия спина в двойных пульсарах (Relativistic spin-precession in binary pulsars) . Authors: Michael Kramer . ... обзор arxiv:1008.2144 Массивные звезды и их сверхновые (Massive Stars and their Supernovae) . ...

Еще в разделе: (Показать все результаты (>83) - astro.uni-altai.ru/ )

. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .

Еще в разделе: (Показать все результаты (>2) - gpu.parallel.ru/ )

... Oxford etc.: Oxford University Press, 2008. 432 p. (Oxford Early Christian Studies). ... III­ VI . ... 59­108). , , . ... 108­318). ... 20- III ., (. 400). (. 437): « (1689: iv, xxxviii) « ». ... 31 1899 .] ... 1911 [1913]. ... 1912 [1915]. ... 152­187; . ... 1915. ... 1911. ... Chron. ... 1- I (380 .) ... 187­189) , 95- 334­428 . ... 4 «» , 7 «The evidence is not compelling» (P. 189). ... 1- ; 1- I (380), (379): 380 . ... 189- , . 1- 250- ; 2- 187- ) . ...

Еще в разделе: (Показать все результаты (>35) - hist.msu.ru/ )

... 8 February , 2014 SAI seminar (Ryde et al 2010) 5 Thermal emission from GRB jet progenitor observer photon jet Photosphere (=1) · · · · Photons are not produced at the photosphere We have to calculate radiative transfer We need to know where the photons are produced We construct the expression for effective optical depth in relativistic flow considering random walk process in relativistic flow SAI seminar 6 8 ... 8 February, 2014 SAI seminar 28 ...

Еще в разделе: (Показать все результаты (>8) - master.sai.msu.ru/ )

... Galeev Elfat Mikhailovich . ... Elfat Mikhailovich Galeev was born on 19.03.1952 in village Chur of Iak-Bodinskii region of Udmurtian Soviet Socialist Republic. After accomplishing his post-graduate studies in 1977 he was taken on the staff of the departmetn of general problems of control. ... He has been a professor of the department since 1998. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>51) - new.math.msu.su/ )

• Кафедра механики композитов МГУ. Научные работы

. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .

Еще в разделе: (Показать все результаты (>3) - npidb.belozersky.msu.ru/ )