... Albert and Barabasi, 2000) Internet Movie Database. -- , , . ... 398 . ... 398­410 Gadjiev B. R., Progulova T. B., Shchetinina D. P., .. MCE ­ 2009, v. 1, pp. 398­410 ( ). : , , ( . ... MCE ­ 2009, v. 1, pp. 398­410 1 0,1 p (k ) 0,01 0,001 0,0001 1 10 k 100 1000 . ... Mathematical Modeling in Social Sciences EVOLUTION OF THE MOVIE ACTOR COLLABORATION NETWORK Gadjiev B. R., Progulova T. B., Shchetinina D. P., Kuzin A. E. We represent model of a growing web of movie actor collaboration network. ...

Еще в разделе: (Показать все результаты (>274) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc185146/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc15822/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc184846/eng.pdf

.

Еще в разделе: (Показать все результаты (>30) - www.chemport.ru/ )

... 2015 . ... The author uses the methods and approaches of redistribution economy in the analysis of the development of timber industry of the Karelian ASSR in the mid 1960s. The role of the Institute of Redistribution as a major factor of regional economy in the system of relations between the Center and Region was examined using unique archival materials never before analyzed scientifically. ... Redistribution economy, institute of redistribution, timber industry, Karelian ASSR. ...

Еще в разделе: (Показать все результаты (>103) - ee-journal.spa.msu.ru/ )

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . outreach . ПРЕЗЕНТАЦИИ Panasyuk M. (SINP, Russia). Relec . ШКОЛЬНИКАМ Using a database of university satellite "Vernov" in school project work. Использование данных университетского спутника "Вернов" в школьных проектах. Experiment and database description | Описание эксперимента и базы данных(doc file ~6 Mb) . Database files (FTP archive) | Файлы данных (FTP-архив) .

Еще в разделе: (Показать все результаты (>4) - vernov-relec.sinp.msu.ru/ )

... TWiki ? ... Adding, renaming and deleting webs are all web-based operations. ... There are two methods used to create a new web. ... All topics in the template web will be copied into your new web. ... You can create hierarchical webs via the Adding a New Web form above, by using a slash- or dot-separated path name which is based on an existing web name in the Name of new web: field. ... To create a subweb named Bar inside a web named Foo , use Foo/Bar or Foo.Bar as the new web name in the form...

Еще в разделе: (Показать все результаты (>35902) - dualopt1.cmm.msu.ru/ )

• TWikiUpgradeGuide - TWiki - TWiki
• %TOPICTITLE% (3 vs. 4) - TWiki
• %TOPICTITLE% (33 vs. 34) - TWiki

This module provides for user authentication using text files. ... Available after Apache 1.3.20] The supplied username and password must be in the AuthUserFile database, and the username must also match the system's name for the owner of the file being requested. ... Available after Apache 1.3.20] The supplied username and password must be in the AuthUserFile database, the name of the group that owns the file must be in the AuthGroupFile database, and the username must be a member of that group. ...

Еще в разделе: (Показать все результаты (>71) - neptun.sai.msu.ru/ )

• Apache modules
• Why We Took PEM Out of Apache
• Apache module mod_auth_dbm

... Nonlinear Standing Waves in an Acoustical Resonator with the Longitudinal Mean Temperature Distribution . ... This paper deals with the problem of nonlinear standing waves in the axisymmetrically shaped acoustic resonators where a mean temperature is distributed along their axis. ... The one-dimensional model equation for nonlinear standing waves of the 2-nd order including a viscous boundary layer is modified to take into account a longitudinal distribution of mean temperature. ...

Еще в разделе: (Показать все результаты (>330) - acs366.phys.msu.su/ )

... Next: Addition and Subtraction of Up: Data Analysis (Operations Menu) Previous: Fourier Transform Contents Index . The Command Histogram leads to the appearance of the Window, which present the distribution of individual points of the surface over its height. ... By Menu Command Histogram/ Cutoff the height of each point which is outside the vertical lines becomes equal to the height pointed by the corresponding vertical line. ...

Еще в разделе: (Показать все результаты (>69) - www.spm.genebee.msu.ru/ )

• Scanning Probe Microscopy Group

Creation of Russian Speech Databases: Design, Processing, Development Tools Vladimir L. Arlazarov (1), Dimitri S. Bogdanov (1), Olga F. Krivnova (2), Aleksandr Ya. ... The second is a text file with annotation of recorded speech (including text, pronunciation, type of recording and labeling, speaker personal data, etc.) ... One of the main requirements to the speech corpus was to provide full phoneme coverage per speaker and full allophone coverage integrally in main sets of the corpus. ...

Еще в разделе: (Показать все результаты (>293) - www.philol.msu.ru/ )

• LangueDOC :: Courses

... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>4846) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• http://kodomo.fbb.msu.ru/~element/Term3/gomolog.txt

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... Форумы > Книжная барахолка > Тема . ... Форумы Список тем Новая тема . ... Продам: Книгу с курса Microsoft - Administering a Microsoft SQL Server 2000 Database . Продам книжку с официального учебного курса Microsoft . M2072 Administering a Microsoft SQL Server 2000 Database на англиском языке за 200$ c дисками за 265$ (4 диска - 2 учебных и 2 установычных для SQL базы) торг. т.926-529-14-13 . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>105) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Research assistant in a world leading

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>18) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/qprice.pdf

. Scobeltsyn Institute of Nuclear Physics , . Moscow State University , . Experimental High Energy Physics Department . RU-119899, Moscow, Russia . Phone (work) :(+7)(095)939-5881 . Fax :(+7)(095)939-3064 . E-mail : dudko@lev.art.ru . (.ps.gz) . (.ps.gz) , pdf . (.ps.gz) , pdf .

Еще в разделе: (Показать все результаты (>8) - top.sinp.msu.ru/ )

... Miklukho-Maklaya 16/10, Moscow, 117997, Russia, +7(495)3366455, alexei@nmr.ru . ... Analysis of PS microdistribution in tissues as a function of time after PS injection (topical or oral application) helps to characterize a selectivity of PS accumulation in tumor cells and other tissue structures; to reveal correctly a maximum of time profile of its tumor accumulation and to recognize the features of PS tissue distribution (spatial and temporal) at different ways of PS application. ...

Еще в разделе: (Показать все результаты (>80) - www.msm.biophys.msu.ru/ )

... Authors: Rosine Lallement et al. arxiv:1309.4284 RAdial Velocity Experiment (RAVE): четвертый релиз данных (The RAdial Velocity Experiment (RAVE): Fourth data release) . Authors: G. Kordopatis et al. arxiv:1309.0013 Поток молекулярного газа массой 10 миллиардов масс Солнца, истекающий от радиопузырей ярчайшей галактики в скоплении Abell 1835 (A Ten Billion Solar Mass Outflow of Molecular Gas Launched by Radio Bubbles in the Abell 1835 Brightest Cluster Galaxy) . ... Authors: T. W. Murphy Jr . ...

Еще в разделе: (Показать все результаты (>336) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1511.html
• http://xray.sai.msu.ru/~polar/sci_rev/0610.html
• http://xray.sai.msu.ru/~polar/sci_rev/1201.html

International Laser Center of MSU . ... Education . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... In our work we have obtained analytical expressions, which describe the distributions of intensity and polarization in the cross-section of a second-harmonic (SH) light beam. It is found that the polarization state drastically changes along the cross-section of the signal light beam. ...

Еще в разделе: (Показать все результаты (>105) - ilc.phys.msu.ru/ )

• Публикация
• Grant detail
• Laboratory of nonlinear polarization optics

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>4) - oc.cs.msu.ru/ )

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

... Программа на сентябрь 2008 г. 24 сентября. H. Wakaki (Hiroshima University). An error bound for Box's chi-square type asymptotic expansion of Wilks' Lambda distribution. Abstract. An error bound for the Box's chi-square type asymptotic expansion of Wilks' Lambda distribution is derived. It is compared with an error bound for the high-dimensional Edgeworth expansion. ... Convergence of Multinomial Goodness-of-fit Statistics to Chi-square Distribution. ...

Еще в разделе: (Показать все результаты (>69) - new.math.msu.su/ )

• http://new.math.msu.su/department/probab/bsk10_14.htm
• http://new.math.msu.su/department/probab/bsk11_13.htm
• http://new.math.msu.su/department/probab/bsk_28_04.pdf