... Полная версия этой страницы: PhD positions in Switzerland . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... 2 PhD positions in multiscale modeling of cancer tumor induced microcirculation . ... The students will be enrolled in the graduate program in the Faculty of Informatics, and will work with Prof. Igor Pivkin on multiscale modeling of tumor induced microcirculation. ... Multiscale Modeling of Tumor Microcirculation . ... All PhD positions have a starting date January 2012. ...

Еще в разделе: (Показать все результаты (>705) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > PhD Position at GSI Darmstadt, Germany
• PhD positions in Switzerland - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > M.Cs. in computer science and electronics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Геометрически точная теория контактных задач: коваринтный подход в численном моделировании. ... Wriggers, P. Computational Contact Mechanics. ... Konyukhov, A., Schweizerhof, K. Contact formulation via a velocity description allowing efficiency improvements in frictionless contact analysis. Computational Mechanics, 33, 165-173, 2004. ... Konyukhov, A., Schweizerhof, K. Development of a model for contact surfaces including friction and adhesion. 7th World Congress on Computational Mechanics. ...

Еще в разделе: (Показать все результаты (>67) - new.math.msu.su/ )

• http://new.math.msu.su/Sites/demosite/Uploads/abstractsm50.58D32DCEDD634CB0AA8244EDE617F1DB.pdf

... Форумы > Аспирантура > Тема . ... MSc/PhD in Computer Science at Clemson University . We are looking for an outstanding candidate for a Ph.D. position in the School of Computing at Clemson University, starting summer or fall 2014. ... The School of Computing has 42 faculty members, more than 400 undergraduate majors, and over 200 graduate students collectively across its three divisions: Computer Science, Visual Computing, and Human-Centered Computing. ... School of Computing . ...

Еще в разделе: (Показать все результаты (>6510) - www.mmonline.ru/ )

• Rover Computers стимулирует студентов: сдал сессию на 5 - добавил память в
• MMOnline | Новости | Rover Computers стимулирует студентов: сдал сессию на 5 -
• MMOnline | Форумы | Аспирантура | Аспирантура в Порту, Португалия

... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...

Еще в разделе: (Показать все результаты (>2) - www.universe.msu.ru/ )

... This file is written in text format and consists from several sections. The order of this sections doesn't important. ... These sections should be described in the file: init , sample , var , var.scale (not nessesarly) , var.display (not nessesarly). ... init_read - Number of bytes needed to be read after string init have been sent. ... If additional data channel is enabled ( 2.1.2 ) during DSP board initialization it sends strings [init]init to chosen COM-port and reads [init]init_read bytes. ...

Еще в разделе: (Показать все результаты (>102) - www.spm.genebee.msu.ru/ )

• Ordering Windows
• Temperature calibration file format
• SPM Set-up

... Polchinski-Strassler) coupling energy Dual to QCD? ... Perturbation theory Lattice Conjecture: specific gauge theory in 4 dim = specific string theory in 10 dim Perturbation theory Lattice In practice: gravity (low energy limit of string theory ) in 10 dim = 4-dim gauge theory in a region of a parameter space Dual gravity Perturbation theory Lattice Can add fundamental fermions with Computing real-time correlation functions from gravity To extract ...

Еще в разделе: (Показать все результаты (>175) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/persons/VEKSLER/veksler100/reports/reports/Toneev_100VIV.11.10.07.pdf
• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/Teryaev_lom09.pdf

... Angewandte Chemie International . Chemical Physics Express . ... HYLE - An International Journal for the Philosophy of Chemistry . ... Journal of Molecular Modeling . ... Journal of Vacuum Science & Technology . Polarization Spectroscopy of ordered systems (PSOS Newsletters). PBMRT - Bio/Chemical Journals and Newsletters . Protein Science . Chemical Physics Preprint Database . The Journal of Physical Chemistry . ... Journal of Chemical Information and Computer Science . ...

Еще в разделе: (Показать все результаты (>22) - www.kge.msu.ru/ )

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

• InCO persons In English
• InCO General Information In English

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>69) - old.philol.msu.ru/ )

• MSU-LGCLL:: O.V. Kukushkina, A.A. Polikarpov, D.V. Khmelev - Authorship
• Using Markov Chains for Identification of Writers
• Using Literal and Grammatical Statistics\\ for Authorship Attribution

... Наука >> Вычислительная математика >> Теория и алгоритмы | ... Научная дисциплина с неоднозначно переводимым на русский язык названием Theoretical Computer Science (теоретическая компьютерная наука? или все-таки информатика? я в любом случае буду для краткости использовать аббревиатуру TCS) существует в виде, более-менее напоминающем современный, около сорока лет. ... Этот переход во многом стимулировался пониманием того, что даже для наиболее базисных задач эти две вещи далеко не одно и то же. ...

Еще в разделе: (Показать все результаты (>209) - www.nature.web.ru/ )

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>25) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf

ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...

Еще в разделе: (Показать все результаты (>29) - www.sai.msu.ru/ )

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>16) - smdc.sinp.msu.ru/ )

International Laser Center of MSU . ... Scientific Laboratories . Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>92) - ilc.phys.msu.ru/ )

• "Computers and measurements" practical course laboratory
• Practice

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>14) - astrometric.sai.msu.ru/ )

• Computer....

Myotis . Uropatagium venation pattern in bats as diagnostic character (by the example of genus Myotis ) . ... By the example of genus Myotis it was shown that venation pattern on uropatagium of bats in some cases can be used as diagnostic character. Venation features on uropatagium allow easy to separate Daubentonв?Ts bat, eastern water bat, big-footed bat, and pond bat from Brandtв?Ts bat, Siberian bat, whiskered bat, and Ikonnikovв?Ts bat. ... Bats]. ... Bats of the Russian Far East]. ...

Еще в разделе: (Показать все результаты (>1678) - zmmu.msu.ru/ )

• Order Chiroptera
• Towards the taxonomy of the Russian Murina (Vespertilionidae, Chiroptera)

Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "238900_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . HUGO gene identifier example: 1681 . ...

Еще в разделе: (Показать все результаты (>319) - mouse.belozersky.msu.ru/ )

• Geometrical core
• wLake algorithm description

... Cleo batch system is purposed to control parallel tasks on computer clusters. It controls one or more task queues. tasks sceduling (all MPI implemetations are supported, most other parallel environments are supported too) . ... controllable user limits (max used cpus, task work time, etc.) . ... Any task in main will be queued to daughter queues if there aren't enough free own cpus (not shared with daughters). When daughter queues will get enough cpus for this task, it will be runned in main . ...

100. hpc@cmc | Высокопроизводительные вычисления на ВМК МГУ