... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... Fortran GNS Language . ... The system RAMPA is designed to create, debug and monitor parallel programs for MIMD distributed-memory machines. ... The system will also allow the development of programs with Fortran GNS, Fortran 77 and C languages, extended with tools from specially made library for parallel programs support. ... Above that, using the instrumental computer for debugging could help a programmer to rewrite his sequential program into parallel one written in Fortran DVM language. ...

Еще в разделе: (Показать все результаты (>126) - sp.cs.msu.ru/ )

• Development of portable program system
• Logic and Databases
• Lib-DVM. Detailed design

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Еще в разделе: (Показать все результаты (>20) - lcc.chem.msu.ru/ )

... OPERA main features: 1) long baseline, 2) high neutrino energy, 3) Kton detector mass , 5) detect short lived taus produced in tau neutrino interactions L = 730 km CERN T flight = 2. 44 m s LNGS Expected neutrino interactions for 22.5x1019 pot: ~ 23600 µ CC + NC ~ 160 e + e CC ~ 115 CC (m2 = 2.5 x 10-3 eV2) 2 CNGS neutrino beam performances 2006 2007 2008 2009 2010 0.076x1019 pot 0.082x1019 pot 1.78x1019 pot 3.52x1019 pot 1.74x1019 pot (19 July) Commissioning ...

Еще в разделе: (Показать все результаты (>156) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/popov.aa-qfthep2010.pdf
• http://qfthep.sinp.msu.ru/talks2013/StPetersburg_SM08f.pdf
• http://qfthep.sinp.msu.ru/talks2015/QFTHEP15_Vorotnikov_v9.pdf

Understanding the boundaries between chromosome races of common shrews in terms of restricted movement by individual shrews . ... Data on population density, dispersal and homing in common shrews of the Moscow chromosome race are discussed. ... The boundaries between different chromosome races in continuous forests may be explained in terms of the low probability of dispersal of shrews beyond the area of an independent population. ... Advances in the Biology of Shrews. ... Evolution of Shrews. ...

Еще в разделе: (Показать все результаты (>863) - zmmu.msu.ru/ )

• Russian Journal of Theriology
• Pes muscles and their action in giant anteater Myrmecophaga tridactyla

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>2) - cellbiol.genebee.msu.ru/ )

... Dumb holes - what are they, how do they work Analogue gravity , Hawking radiation and black hole lasers in Bose-Einstein condensates Analogue gravity models in dielectrics (4 (4 (3 (3 (3 (3 hours hours hours hours hours hours ) ) ) ) ) ) Matt Visser, Victoria University of Wellington, New Zealand Theodore Jacobson, University of Maryland, USA Ralf SchЭtzhold, UniversitДt Duisburg-Essen, Germany William Unruh, ...

Еще в разделе: (Показать все результаты (>157) - phys.msu.ru/ )

• Кафедра квантовой статистики и теории поля
• Title

... Is it necessary to do the beam weaker? ... Q: If the mixture of powders consists of both isotropic and anisotropic particles, is it possible to estimate the ratio of isotropic and anisotropic parts? If I understand the question correctly, one asks, if one has a fraction of oriented anisotropic particles and a fraction of the disoriented anisotrpic particles (i.e. one has somewhat partial texture in the powder sample), then is it possible to find out these fractions? ...

Еще в разделе: (Показать все результаты (>18) - www.elch.chem.msu.ru/ )

... Therefore, we should aim at continuously increasing our understanding of pedogenic processes, their rates, and the ways in which they are influenced by soil forming factors, including man, in order to build a reliable basis for the correct and efficient use of the potential of the soil archive. One important step in this direction was the conference "Global Soil Change: Time-Scales and Rates of Pedogenic Processes" in May 2005 in Mexico . ...

Еще в разделе: (Показать все результаты (>474) - www.fadr.msu.ru/ )

• EcoPhoto - Архив - Небесные явления Supernal phenomenons
• EcoPhoto - Архив - Seasons of Russia - Природа России - Fall - Осень
• THE ESTABLISHMENT OF THE ALBANIAN MARKET INFORMATION SERVICE

... In this article we considerљcalculationљof discrete Laplacian for 1D arrays usingљpython/numpy/scipy. We introduceљthe sparse matrix technique that is rather efficient for computation of certain types of diffusion PDE. ... 1 комментарий " Constructing discrete Laplacian via sparse matrix " . Reaction-diffusion systems in 2D space with python ERG Research Group: Лаборатория теоретической биофизики написал (Январь 26th, 2016 2:13 пп) . ... Constructing discrete Laplacian via sparse matrix . ...

Еще в разделе: (Показать все результаты (>36) - erg.biophys.msu.ru/ )

• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• Visual approach to construction of &QMMM section of CP2K input file ERG
• cp2k ERG Research Group: Лаборатория теоретической биофизики

Monitoring of chloride and chloride-selective ion channels activity using genetically encoded fluorescent sensors. ... Quinoline-based fluorescent dyes sensitive to Cl have low biological toxicity, relatively good sensitivity and selectivity to Cl and rapid response to changes in Cl. ... Thus, development of molecules with sensitivities closer to this physiological range would provide a useful tool for monitoring Cl in biological preparations. ...

Еще в разделе: (Показать все результаты (>59) - www.msm.biophys.msu.ru/ )

• http://www.msm.biophys.msu.ru/archive/doc14886/eng.pdf

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>61) - ecfs.msu.ru/ )

• Online Consultation on Network and Partnerships in the area of Food Security |
• Resources | ECFS
• Login | ECFS

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>14) - suny.msu.ru/ )

• Center on Russia and the United States :: News

... Another strong point of this model is that the participants can reach not only intellectual understanding but also an affective tolerance of cultural differences in the process of intercultural communication (Bennett, 1986). This training model also has its limitations. ... Many scholars and trainers argue that applying a single model of intercultural training may not sufficiently prepare participants to function properly and effectively in a new cultural environment (Chen & Starosta, 1998 : 267). ...

Еще в разделе: (Показать все результаты (>123) - www.prof.msu.ru/ )

• DEMOCRACY FELLOWSHIPS
• Fellowships at the National Endowment for Democracy
• THE ROLE OF YOUTH NGOS

PRL 105, 010404 (2010) PHYSICAL REVIEW LET TE RS week ending 2 JULY 2010 Statistical Estimation of the Efficiency of Quantum State Tomography Protocols Yu. ... It is based on a priori estimation of the quality of an arbitrary protocol by means of universal asymptotic fidelity distribution and condition number, which takes minimal value for better protocol. ... The present approach allows to analyze arbitrary protocols of statistical reconstruction of quantum states. ... 1] M. Genovese, Phys. Rep. ...

Еще в разделе: (Показать все результаты (>87) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf
• http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf
• Home :: Quantum Information Laboratory

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>21) - www.cie.ru/ )

• Documents Confirming Academic Background :: Admissions :: CIE

... The data about the species pattern of the lake flora were collected. During summer biological practics and expeditions of Moscow Gymnasium on Southwest, which took place in the Thupa region, at Tchupa gulf of the White Sea, and in Udomelsky region, of Tverskaya province, near the lake Moldino, since 1999 till 2001. 17 lakes of the Tchupa gulf environ and 4 lakes of Tverskaya province were studied. ... We designed a method of studying selected blocks for the description of flora. ...

Еще в разделе: (Показать все результаты (>180) - herba.msu.ru/ )

• Index of /shipunov/school/biol_240/en
• Department of Mycology and Algology

... The Geostatistical Software Tool is the leading block modeling software in Russia . ... The source data, block models, solids and surfaces are importable/exportable. Block models may hold any quantity of properties. ... Variogram model, trend model, data transform model, declusterisation model, parameters of the search ellipsoid, lriging type, kriging strategy – are considered not as separate things, but as parts of the complete variability model , that is managed from one point. ...

Еще в разделе: (Показать все результаты (>448) - geo.web.ru/ )

• Второе приглашение на научно-практическую конференцию "Современные методы
• COMAGMAT MODEL
• Comagmat software

... Invariants for Generalised Burgers Equations . ... Recently, one of the authors (NHI) adopted the infinitesimal method for calculating invariants of families of differential equations using the equivalence groups. ... Here, we use the above method for calculating invariants of the family of generalised Burgers equations which has applications in acoustic phenomena and furthermore has been used to model turbulence and certain steady state viscous flows. ...

Еще в разделе: (Показать все результаты (>180) - acs366.phys.msu.su/ )

• AUTHOR : Ibragimov N

Academy of Science, Engineering and Technology International Journal of Mathematical, Computational, Physical and Quantum Engineering Vol :8 No:10, 2014 Application of Adaptive Neural Network Algorithms for Determination of Salt Composition of Waters Using Laser Spectroscopy Tatiana A. Dolenko, Sergey A. Burikov, Alexander O. Efitorov, Sergey A. Dolenko ... Nickolov, "Determination of salts in water solutions by a skewing parameter of the water Raman band," Applied Spectroscopy, vol. 38, no. 4, pp. ...

Еще в разделе: (Показать все результаты (>28) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Using.pdf
• http://rswater.phys.msu.ru/en/articles/2014/Nanosystems_CD_ANN_2014.pdf
• http://rswater.phys.msu.ru/en/articles/2013/opt%20mem.pdf