Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

... Loskutov, and E. V. Ryadchenko Presented by Academician A.R. Khokhlov April 22, 2005 Received April 26, 2005 The problem of the identification and biological significance of chromosome fragments and complete genomes is approached on the basis of the representation of a sequence of DNA nucleotides as a two-dimensional walk. ... However, as applied to DNA, functional and structural fragments of a chromosome may be distinguished by a typical walk "pattern" only for a sufficiently large number of units....

Еще в разделе: (Показать все результаты (>59) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/prokhorov/phd/phd.htm
• http://chaos.phys.msu.ru/loskutov/PDF/Galss_ceramics.pdf

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>37) - shamolin2.imec.msu.ru/ )

• Maxim V. Shamolin Home Page

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>34) - hpc.msu.ru/ )

• Nationwide Supercomputing Education Project | Moscow University Supercomputing

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>14) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific
• Alexander Pozdneev at the ASMS 2008 Conference | Department of the Automation

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>7) - www.sciencepark.ru/ )

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>8) - physcontrol.phys.msu.ru/ )

• List All Categories

The Advanced Studies program of study visits is addressed to young professionals (students, academics, NGO representatives, teachers, and journalists) from Ukraine, Belarus, Moldova, Russia (8-10 from each country) who: . ... promotion of human rights and civil liberties . ... 3. start cooperation with their peers and experts from Poland, Slovakia, the Czech Republic and Hungary, as well as from the other EU countries. The AS visits will take place in the period of 12-23 May 2006 in Krakow . ...

Еще в разделе: (Показать все результаты (>135) - www.prof.msu.ru/ )

• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• Welche Rolle spielen internationale Erfahrungen bei der Entwicklung einer
• SELF-DISCOVERY, DIVERSITY, FLEXIBILITY AND ACADEMIC EXELLENCE IN THE CONTEXT OF

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>114) - www.fadr.msu.ru/ )

• "EcoPhoto" - Order photo - CD
• Фотоархив "EcoPhoto" - Заказ фото - CD
• Online Registration

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>21) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Advance registration
• Foreword

... In this article we considerљcalculationљof discrete Laplacian for 1D arrays usingљpython/numpy/scipy. We introduceљthe sparse matrix technique that is rather efficient for computation of certain types of diffusion PDE. ... 1 комментарий " Constructing discrete Laplacian via sparse matrix " . Reaction-diffusion systems in 2D space with python ERG Research Group: Лаборатория теоретической биофизики написал (Январь 26th, 2016 2:13 пп) . ... Constructing discrete Laplacian via sparse matrix . ...

Еще в разделе: (Показать все результаты (>28) - erg.biophys.msu.ru/ )

• Reaction-diffusion systems in 2D space with python ERG Research Group:

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>31) - nano.msu.ru/ )

• Fundamentals of Nanotechnology, 2009 | MSU Nanotechnology Education and
• Information on interfaculty and interdisciplinary seminars on advanced fields
• Registration for the International School ?Computer simulation of advanced

... GeneBee . ... Advanced GeneBee Motifs' Collection Map . ... General options . Number of motifs to plot . Map title . Number of motifs to output . DotHelix options . ... Dothelix Power threshold . ... DotHelix . ... DNA/RNA Dayhoff Johnson Blosum 30 Blosum 50 Blosum 62 Pam 60 Pam 120 Pam 250 Gonnet 120 Gonnet 250 Gonnet 350 . Other options . ... Motif frequences . ... Comments and bug-reports send to: nik@genebee.msu.su ...

Еще в разделе: (Показать все результаты (>182) - www.genebee.msu.ru/ )

• Лаборатория регуляции белкового синтеза
• NCBI BLAST Advanced Options
• GeneBee Graphical Alignment - Advanced

MATSYM - symbolic matrix processor . ... To use the program you will need a MAT file (liked CIR file: "User manual for CIRSYM program") of your system. ... In first string of MAT file enter any text you want to be the title of your system. ... Starting from string 2 (if is not comments - "*") enter the system element name, incident row and column and, optionally, its value. ... To generate a solution, run MATSYM.exe and enter "system_file_name.CIR" or click on the "ENTER" (in "MAT" case). ...

Еще в разделе: (Показать все результаты (>19) - astrometric.sai.msu.ru/ )

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>5) - www.students.chemport.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Olympiads . ... All-army olimpiad . ... Olympiad for School Pupils . ... Olympiad for school pupils was held in 2005 under the motto ?Via scientiarum?, which means ?The way to the knowledge? in Latin. ... The 46 th Mendeleev International Olympiad in Chemistry for School Pupils was held in Kazakhstan in the 2011-2012 school year. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>101) - talant.msu.ru/ )

• Robot Ball ? 2014 | The Department of Talented Youth Affairs and Professional

T he student body is the central group of the Faculty of Physics. ... The Faculty offers its students the widest choice of training programmes and majoring opportunities. ... C urrently there are about 40 general courses and over 650 specialized courses delivered covering a wide range of traditional and new areas of physics research. ... F rom the first year students can be trained under two programs physics or astronomy. ... T here is a specific education system in place at the Faculty of Physics. ...

Еще в разделе: (Показать все результаты (>21) - foroff.phys.msu.ru/ )

• Admission Regulation
• Key research directions

... General Catalog of Variable Stars (GCVS database, Version 2015Sep) . ... Query forms . ... Enter The Type of the Variability : ACV ACV+ DSCT : ACV+ DSCTC ACV: ACVO ACVO: ACYG ACYG: AM AM/XRM+E AM: BCEP BCEP (B) BCEP +E BCEP +E: BCEP +EA/D BCEP + ELL : BCEP : BCEPS BE BE+ BCEP : BE: BLBOO BLLAC BY BY+UV BY+UV: BY: BY:+E: BY:+UV: CEP CEP(B) CEP: CST CST: CW CW: CWA CWA: CWB CWB: DCEP DCEP(B) DCEP: DCEPS DCEPS(B) DCEPS: DSCT DSCT (B) DSCT (B:) DSCT : DSCTC DSCTC (B) DSCTC +E DSCTC +E...

Еще в разделе: (Показать все результаты (>77) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Vols I-III (the new electronic version).
• Презентация PowerPoint
• Конференции сайта АстрО. J E N A M - 2 0 0 7

Gauss-Laguerre Keypoints Descriptors for Color Images Andrey S. Krylov and Dmitry V. Sorokin Laboratory of Mathematical Methods of Image Processing, Faculty of Computational Mathematics and Cybernetics, Lomonosov Moscow State University, http://imaging.cs.msu.ru Email: {kryl, dsorokin}@cs.msu.ru Abstract--Keypoints descriptors construction algorithm for color images is introduced. ... V. C ONCLUSION Keypoints descriptors construction algorithm for color images was introduced. ...

Еще в разделе: (Показать все результаты (>101) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.ICIAR.Sorokin_Mizotin_Krylov.GaussLaguerreKeypoints.en.pdf
• http://imaging.cs.msu.ru/pub/Superresolution08.pdf
• http://imaging.cs.msu.ru/pub/2011.orgw.Storozhilova_Yurin.FastRank.pdf