Astronomy Picture of the Day . ... 15.02.1996 . ... Galaxies and long filaments formed - which are shown by the bright patches and streaks in the above frame . ... February . ... February 1996 . ... NASA Web Site Statements, Warnings, and Disclaimers . ... Publications with keywords: early universe . Publications with words: early universe . ... GRB 090423: The Farthest Explosion Yet Measured . Building Galaxies in the Early Universe . ... Unexpected Galaxy String in the Early Universe . ...

Еще в разделе: (Показать все результаты (>6453) - www.astronet.ru/ )

• Астронет > The Early Universe
• Journal "Peremennye Zvezdy"

Russian abstract] . Russian full text] . The classifications revealed by geometric morphometry and classical morphometry for Drosera rotundifolia , D. obovata , D. anglica and D. linearis were compared. ... the form of petiole middle part transverse section is the effective distinguishing character for the some different species and inter-species hybrids of Drosera ; . the consensus configurations are preferable for the geometric morphometry analysis of populations. ...

Еще в разделе: (Показать все результаты (>190) - herba.msu.ru/ )

... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...

Еще в разделе: (Показать все результаты (>59) - www.msm.biophys.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>39) - eng.geogr.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>3) - www.eng.geogr.msu.ru/ )

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . ... Регистрация . ... Серия Blue Gene в мире . ... Доступ по SSH . ... Регламент доступа . ... С 2008 года на факультете ВМК МГУ имени М. В. Ломоносова работает суперкомпьютер IBM Blue Gene/P, который является одной из первых систем данной серии среди установленных в мире. Архитектура Blue Gene была предложена компанией IBM в рамках проекта по исследованию возможностей достижения новых рубежей в супервычислениях. ...

Еще в разделе: (Показать все результаты (>7) - hpc.cmc.msu.ru/ )

... Cleo batch system is purposed to control parallel tasks on computer clusters. It controls one or more task queues. tasks sceduling (all MPI implemetations are supported, most other parallel environments are supported too) . ... controllable user limits (max used cpus, task work time, etc.) . ... Any task in main will be queued to daughter queues if there aren't enough free own cpus (not shared with daughters). When daughter queues will get enough cpus for this task, it will be runned in main . ...

Еще в разделе: (Показать все результаты (>2) - parcon.parallel.ru/ )

... Publications :: Differentiated Sills . ... Ariskin A.A., Barmina G.S., Frenkel M.Ya., Nielsen R.L. COMAGMAT: a Fortran program to model magma differentiation processes. ... Ariskin A.A., Barmina G.S. COMAGMAT: Development of a Magma Crystallization Model and Its Petrological Applications. ...

Еще в разделе: (Показать все результаты (>295) - geo.web.ru/ )

• Pletchov Pavel biography info
• COMAGMAT MODEL
• Результаты конкурса Schlumberger Scholarship Program - 2010 - Все о Геологии

... Студенты, обладающие визой F-1 в Соединенных Штатах Америки , теперь могут сделать изменения, объявленные в апреле, в программе Общего практического обучения. Срок программы обучения был продлен от 12 месяцев до 29 и теперь позволяет определенным студентам визы F-1 работать в США по профессиям, относящимся к области обучения студентов. ... Data Processing and Data Processing Technology/Technician. ... Architectural Engineering Technology/Technician. ... Civil Engineering Technology/Technician. ...

Еще в разделе: (Показать все результаты (>437) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: 7 апреля компания WebScan Technologies представила
• Клуб выпускников МГУ: Список востребованных профессий Австралии
• Клуб выпускников МГУ: Senior International Fellows Program

... О UNИX . ... Every time you copy those files (and modify the configuration of your server accordingly), you create what is called a wiki instance . ... Some of the steps you need to take depend on which web server and which operating system you use. ... it is also possible to put the web server and the normal user in the same group , and then only open the instance directory to the members of that group. ... Now, you need to tune the configuration of your web server and of your wiki instance. ...

Еще в разделе: (Показать все результаты (>210) - uneex.mithril.cs.msu.su/ )

• HelpOnInstalling/Win32MoinEasyBackup - UNИX
• HelpOnSubscribing - UNИX
• eSyr/BuildSystemsCoursePlan/010Exec - UNИX

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>59) - geophys.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Near-surface electrical prospecting laboratory at Moscow University
• IPI_MTS - 1D interpretation of MTS and FS (freeware).

... Program . ... Сидоров Е.А. О сосуществовании разнознаковых квазипериодических решений некоторых классов дифференциальных уравнений . ... Корнев С.В. Метод направляющих функций и некоторые его развития для дифференциальных включений . ... Юлдашев Т.К. Вопросы корректности для нелинейных интегральных и интегро-дифференциальных уравнений Вольтерра . ... в теории обыкновенных дифференциальных уравнений . ... Саввина О.А. Высшая математика для старших школьников в представлении Л.С. Понтрягина . ...

Еще в разделе: (Показать все результаты (>49) - pont2008.cmc.msu.ru/ )

• Program International Conference Differential Equations and Topology dedicated
• Program Committee International Conference Differential Equations and Topology

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

The Department of Talented Youth Affairs and Professional Orientation . ... Older posts . ... Posted on 02.02.2016 by editor . ... From 4 to 6 February 2016, Lomonosov Moscow State University will host the II Interregional Chemical Tournament ? ... Posted on 28.12.2015 by editor . ... January 10, 2016 Moscow University invites you to an open day that isto be held in the main building of Moscow State University. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>31) - talant.msu.ru/ )

• News | The Department of Talented Youth Affairs and Professional Orientation |
• admin | The Department of Talented Youth Affairs and Professional Orientation

. General Physics Chair, . Physics Department, MSU . Topics . Education . Demonstrations . Dear colleagues, . Here you can find the following: . Education: general physics course program. Demonstrations: computer demonstrations. Русская версия . 01 Nov, 2010 . Contacts .

Еще в разделе: (Показать все результаты (>17) - genphys.phys.msu.su/ )

Information Security Meeting Schedule Thursday, March 30 12:00 noon Opening and Catered Lunch 1:00 R. Sekar, Stony Brook University - Ongoing Research at Secure Systems Laboratory at Stony Brook University 1:30 Scott Craver, Binghamton University - Information Hiding and Counterdeception 2:00 Sanjay Goel, University at ...

Еще в разделе: (Показать все результаты (>34) - suny.msu.ru/ )

• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities
• Центр по делам России и США :: Публикации
• Center on Russia and the United States :: SUNY Professional Fellows Program

... of engineering and ecological geology . ... Department of Engineering and Ecological Geology invites foreign students for training programs. During education the students of the Department gain both fundamental and applied knowledge by the following specializations: Engineering Geology, Soilscience and Soil Stabilization, Environmental Geology and Ecological Geology. ... Korolev V.A. 5 . ... Isotope methods in engineering geology . ... Mathematical methods and computers in engineering geology . ...

Еще в разделе: (Показать все результаты (>71) - www.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Faculty of Geology >> Geology at Moscow State University
• Near-surface electrical prospecting laboratory at Moscow University

... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, S. Ostrouchov, and D. Sorensen, LAPACK Users' Guide, Society for Industrial and Applied Mathematics, Philadelphia, PA, second ed., 1995. ... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, and D. Sorensen, LAPACK: A portable linear algebra library for high - performance computers, Computer Science Dept. ...

Еще в разделе: (Показать все результаты (>229) - num-anal.srcc.msu.ru/ )

• Наречные обороты
• БЧА НИВЦ МГУ. Линейная проблема собственных значений. Рекомендации по

T he student body is the central group of the Faculty of Physics. ... The Faculty offers its students the widest choice of training programmes and majoring opportunities. ... C urrently there are about 40 general courses and over 650 specialized courses delivered covering a wide range of traditional and new areas of physics research. ... F rom the first year students can be trained under two programs physics or astronomy. ... T here is a specific education system in place at the Faculty of Physics. ...

Еще в разделе: (Показать все результаты (>29) - foroff.phys.msu.ru/ )

• Faculty's Tuition Structure
• Postdoctoral training (General Physics and Wave Processes)
• Programs, numerical algorithms