... Geography of World Economy . ... Belozerova E. Sediment fluxes in transboundary Selenga river basin // Proceedings of European Geosciences Union General Assembly in Vienna, Austria, 07 12 April 2013 . ... Nikolay Kasimov Sergey R. Chalov, M.Yu.Lychagin Hotspots within the Transboundary Selenga River Basin // Proceedings of European Geosciences Union General Assembly in Vienna, Austria, 07 12 April 2013 . ... Chalov S., Belozerova E., Nikolaev I. Water and sediment fluxes in Selenga river system. ...
... Труды ЗБС . ... Новости . 2014 . ... Программа лекций на практике на ЗБС МГУ, лето 2014. ... Звенигородская биологическая станция ? ... Звенигородская биологическая станция имени С.Н. Скадовского Биологического факультета Московского государственного университета имени М.В. Ломоносова является учебно-научным центром междисциплинарных фундаментальных и прикладных исследований, . ... 12, МГУ, Биологический ф-т., . ... 2016 Звенигородская биологическая станция имени С.Н.Скадовского . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Moscow State University, Geological Faculty, Dept. of Geophysics . ... March 2000 In 1999 the TRF_2D automated 2D inversion Program for VES travers data was developed by Near-Surface Electrical Lab. ... Automated 2D Inversion Basics . TRF_2D for Windows Principal Specifications . TRF_2D for Windows Test Example . Using TRF_2D for Windows - Field Example . TRF_2D for Windows Limitations for Usage . ... Dept. of Geophysics, Geological Faculty, MSU . ...
... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...
CSA Call Information Call Title: Call for proposals for ERC CSA (Supporting action) Call identifier: ERC-2009-Support Date of publication: 24 July 2008 Call deadline: 12 November 2008, at 17.00.00 (Brussels local time) Indicative budget: EUR 2 500 000 1 from 2009 budget The upper limit for the Community financial contribution is 100%. ... Co-ordination and support actions (Support) are open to Associated countries. ... The minimum participation is 1 independent legal entity (CSA-Support). ...
The Journal "Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika" is a periodical scientific publication that reflects the topics of the important directions of theoretical studies in mathematics and mechanics in the M.V. Lomonosov Moscow State University. ... The Founders of the Journal "Vestnik Moskovskogo Universiteta. ... Mekhanika" are the M.V. Lomonosov Moscow State University and the Faculty of Mechanics and Mathematics . ... Faculty of Mechanics and Mathematics . ...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
Общее . ... Геология в Московском университете . ... Профком геологического факультета . ... Геологический факультет МГУ всемирно известный учебно-научный центр России. ... Вся деятельность сотрудников факультета направлена на развитие геологической науки, образования и культуры необходимых условий экономического и духовного возрождения России. ... 119991, Российская Федерация, Москва, ГСП-1, Ленинские горы, Московский государственный университет имени М.В. Ломоносова, Геологический факультет, . ...
... T-pion fields T-baryon fields DM candidate · Stability on cosmological time scales · Weak participation in the electromagnetic interaction Roman Pasechnik, Vitaly Beylin, Vladimir Kuksa, Grigory Vereshkov. arXiv:1407.2392 (2014) T-baryon mass splitting The T-baryon mass splitting is due to the electroweak interaction T-baryon mass splitting , -masses of the weak bosons -Fermi constant - mass of the T-baryon T-baryon ... 208, 19 (2013) T-baryon asymmetry? ...
... Home Resources Publications Agricultural markets and global state of food.. ... Since the beginning of the 2000s the situation in the global agro-food market is characterized by the upward trend against the background of price volatility. The increase in consumption in developing countries, especially China and India, along with rising incomes and a shift in demand for more nutritious foods are some of the factors that determine the long-term increase in demand for agricultural commodities. ...
ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...
... Преснов, Д., Амитонов, С., Власенко, В., иљКрупенин, В. Одноэлектронный транзистор из высоколегированного кремния на изоляторе.љ ... Presnov, D.љE., Amitonov, S.љV., Krutitskii, P.љA., Kolybasova, V.љV., Devyatov, I.љA., Krupenin, V.љA., and Soloviev, I.љI. A highly ph-sensitive nanowire field-effect transistor based on silicon on insulator.љ ... Krupenin, V., Presnov, D., Zalunin, V., Vasenko, S., and Zorin, A. A strongly asymmetric single-electron transistor operating as a zero-biased electrometer...
SEMINAR Singular Perturbations and Time Scales (SPaTS) in Control Theory and Applications 14:30 PM, Saturday, June 23, 2012, Room 5-18 Faculty of Physics, M.V. Lomonosov Moscow State University , Moscow, Russia Professor D. Subbaram Naidu , PhD, PE, Fellow IEEE Director and Professor, School of Engineering Director, Measurement and Control Engineering Research Center Idaho State ...
[
Текст
]
Ссылки http://matematika.phys.msu.ru/files/seminar/189/Naidu_SPaTS_Presentation_MoscowStateUniversity_2012_06_23_Abstract+and+Biography.pdf -- 98.8 Кб -- 14.06.2012 Похожие документы
... Information for the applicants . ... News . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Faculty of Bioengineering and Bioinformatics, office 433. ... 2016 Faculty of Bioengineering and Bioinformatics, . Lomonosov Moscow State University . ...
... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...
... Astronomical Journal . Astronomy and Astrophysics . Publications of the Astronomical Society of the Pacific . Monthly Notice of the Royal Astronomical Society . ... Institute of Astronomy, Saint Peterburg State University . American Astronomical Society . The Astronomical Society of the Pacific . ... Russian Foundation for Basic Research . ... Physical Department of Moscow State University . ... World Caves Data Base . ... Moscow University Caving Club . ... Barrier Caving Club . ...