Russian Language Training via INTERNET. Internet-based educational hypertexts: some results of formal approach. ... Comparative study of Internet-based educational curricula in Russian Phonetics was based upon formal criteria and objective evidence concerning: (1) coincidence of navigational patterns embedded in a web-presentation of course material to main cognitive patterns of students, (2) rate of hypertext optimisation, (3) adjustability to different academic syllabuses and educational modes. ...
... Engineering and ecological geology . ... The Head of the Chair, Professor V.T.Trofimov The Chair of Engineering and Ecological Geology provides students with profound fundamental knowledge and practical skills in the following areas of specialization: "Engineering Geology", "Soil Science and Soil Stabilization", "Environmental Geology and Ecological Geology". ... The Laboratory of regional engineering geology deals with theoretical and methodological problems of engineering geological research. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Russian . Next: Change in inner data Up: Data Analysis (Operations Menu) Previous: Addition and Subtraction of Contents Index . If a closed line of constant height is drawn on the surface, then it is possible to calculate the volume, which is "cut" by the line from the surface. This is done using the Command Isoline Volume . Russian . Next: Change in inner data Up: Data Analysis (Operations Menu) Previous: Addition and Subtraction of Contents Index Filonov 2005-02-04
Call Title: Call for proposals for ERC Starting Independent Researcher Grant Call identifier: ERC -2010-StG Date of publication: 30 July 2009 Electronic proposal submission deadlines1 (single submission of full proposal): 2 Panels ... (Brussels local time) Panels: SH1 SH6 (Social Sciences Humanities), 9 December 2009, 17.00.00 (Brussels local time) Indicative budget : EUR 528 237 600 from 2010 budget3 N.B.: The ... Proposals may be evaluated remotely. ...
... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
Optical imaging of fluorescent carbon biomarkers using artificial neural networks Tatiana A. Dolenko Sergey A. Burikov Alexey M. Vervald Igor I. Vlasov Sergey A. Dolenko Kirill A. Laptinskiy Jessica M. Rosenholm Olga A. Shenderova Downloaded From: http://biomedicaloptics.spiedigitallibrary.org/ on 12/17/ 2014 Terms of Use: http://spiedl.org/terms Journal of Biomedical Optics 19(11), 117007 (November 2014 ) Optical imaging of fluorescent ... Results of Using Artificial Neural Networks Fig. ...
[
Текст
]
Ссылки http://rswater.phys.msu.ru/en/articles/2014/JBO_19_11_117007.pdf -- 801.2 Кб -- 17.12.2014 Похожие документы
... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...
... We present some results of new calculations of D" ( t ) the second derivative of the Moon's elongation as a function of time. ... Let X be a set of all preserved recordings of observations of ancient Sun and Moon eclipses (see the list in [ 2 ], pp. 167 271): let A be a set of eclipses described in X (any eclipse a A may have some records corresponding to it and form X ( a )). ... The recount of dates t ( a 0 ), a 0 A ,( 700) < t ( a 0 ) < (+400), was first made by N. A. Morosov. ...
... Department of Vertebrate Zoology . ... In 1808 the Chair of Zoology and Botany was subdivided into two independent departments and later a Chair of Anatomy was founded by professor D. I. Dvigubsky. ... However in 1878 he was the head of Zoological Department too. ... In the reports of these years one can find not only the Vertebrate Zoology and Comparative Anatomy Departments but also the Departments of Fur Trade Zoology, of Morphology and of Vertebrate Systematics. associate professor E.S.Ptushenko...
... Field of interest: data analysis and interpretation of X-ray observations of BHC and NS systems, astrophysics of compact objects and related phenomena: X-ray , optical and radio observations , shocks and stellar winds, emission mechanism, the spectral and timing analysis of the X-ray emission from microquasars ( signature of accreting BH), atoll- and Z-sources ( signature of accreting NS), modeling of INTEGRAL images % . ...
... Aptamer DNA : A New Type of Thrombin Inhibitors V. A. Spiridonova*,1 E. V. Rog**, T. N. Dugina***, S. M. Strukova***, and A. M. Kopylov** *Belozersky Institute of Physicochemical ... State University, Vorob'evy gory, Moscow, 119899 Russia Received November 13, 2002; in final form, November 21, 2002 Abstract--The formation of complexes between various thrombin preparations and 30-mer aptamer DNA was comparatively studied, and a correlation between the ... 5 2003 Vol. ... Vol. ...
... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf -- 388.0 Кб -- 06.07.2014 Похожие документы
... Following the approach of Daly [1], this paper introduces several algorithm improvements allowing for more accurate calculation of threshold elevation and modeling of the facilitation effect during phase-coherent masking. ... Section 3 introduces the Complex Cortex Transform (CCT) and its computation algorithm. ... CCT cc (9) 4. 4.1 USING CCT FOR MODELING OF MASKING Modeling Threshold Elevation Using CCT Magnitude 3.4 Properties of the Complex Cortex Transform 1. ...
[
Текст
]
Ссылки http://imaging.cs.msu.ru/pub/ComplexCortexTransform09.pdf -- 321.4 Кб -- 31.08.2009
[
Текст
]
Ссылки http://imaging.cs.msu.su/pub/ComplexCortexTransform09.pdf -- 321.4 Кб -- 31.08.2009
[
Текст
]
Ссылки http://imaging.cmc.msu.ru/pub/ComplexCortexTransform09.pdf -- 321.4 Кб -- 31.08.2009 Похожие документы
... Also, if events can be split up into distinct but overlapping events, how do you approximate the fluences of the individual events? ... In any cases, You can observe new increasing the E>30 MeV fluxes after first event. ... And for that case, what should be difference in fluences, predicted by different models. ... Fig. ... For different SEP model characteristics were used different events sets. 183 were physical events, what were used for development of the regularities, inherent to the SEP events....
... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...