Документ взят из кэша поисковой машины. Адрес оригинального документа : http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf Дата изменения: Mon Feb 18 16:25:42 2008 Дата индексирования: Mon Oct 1 19:22:38 2012 Кодировка: Windows-1251

Russian Journal of Bioorganic Chemistry, Vol. 29, No. 5, 2003, pp. 450-453. Translated from Bioorganicheskaya Khimiya, Vol. 29, No. 5, 2003, pp. 495-498. Original Russian Text Copyright ї 2003 by Spiridonova, Rog, Baranov, Dugina, Strukova, Kopylov.

Aptamer DNA: A New Type of Thrombin Inhibitors
V. A. Spiridonova*,1 E. V. Rog**, T. N. Dugina***, S. M. Strukova***, and A. M. Kopylov**
*Belozersky Institute of Physicochemical Biology, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia **Faculty of Chemistry, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia ***Faculty of Biology, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia
Received November 13, 2002; in final form, November 21, 2002

Abstract--The formation of complexes between various thrombin preparations and 30-mer aptamer DNA was comparatively studied, and a correlation between the complex formation and the fibrinogen-hydrolyzing activity of thrombin was found. The aptamer DNA was shown to inhibit the formation of fibrin from fibrinogen. Key words: aptamer DNA, fibrinogen-hydrolyzing activity, inhibitor, thrombin

INTRODUCTION The development of a new technology called SELEX (Systematic Evolution of Ligands by Exponential enrichment) has been determined by the ability of single-stranded nucleic acids to be duplicated and to form complex tertiary structures. Using SELEX, small NA molecules, aptamers, can be obtained; they are functional analogues of monoclonal antibodies according to their specificity and affinity [1-6]. Aptamers can form stable complexes with various targets: proteins, amino acids, nucleotides, and other low-molecular compounds. Aptamers can be used as inhibitors of enzymes, in particular, proteases. The aptamer selection cycle for RNA includes transcription from the DNA template, binding to the immobilized target, removal of the unbound RNA, elution of the bound enriched RNA fraction, the cDNA synthesis on the enriched RNA, and PCR to obtain enough material for the next selection cycle. An asymmetrical PCR is used instead of transcription in the case of DNA selection. Six to ten cycles lead to the aptamer fraction, which can be effectively and specifically bound to a certain enzyme. The preparation of aptamer inhibitors for a number of proteases has been described: RNA aptamers for subtilisin [7, 8] and serine protease NS3 [9] and a DNA aptamer for the elastase from neutrophiles [10-12]. Thrombin is a multifunctional protease involved in the regulation of homeostasis. As an initiator of blood clot formation, thrombin hydrolyzes fibrinogen and activates platelets and some blood coagulation factors that have procoagulant activity. As anticoagulant, thrombin changes its substrate specificity: it is bound to thrombomodulin and activates protein C, the most important blood anticoagulant. There are several types
1

1

of inhibitors that control the thrombin enzymatic activity, such as endogenous (antithrombin III, heparin II cofactor, protease nexin-I, 2-macroglobulin, and 1-antitrypsin [13]); exogenous (girudin); and synthetic (esters of arylsulfonyl-L-arginine, derivatives of benzamidine, etc. [14]). Thrombin does not belong to NA-binding proteins, but it was the first protease for which DNA aptamers capable of interacting with various protein epitopes were obtained by the SELEX technique [15-18]. The structures of aptamers interacting with the fibrin-binding protein region (a model of the tertiary complex structure is presented in Fig. 1a) commonly include two G quartets whose 5'- and 3'-terminal sequences form a DNA duplex (Fig. 1b) [18]. We studied in this work the formation of complexes between various thrombin preparations and the DNA aptamer CAGTCCGTGGTAGGGCAGGTTGGGGTGACT whose sequence contains the motif shown in Fig. 1b. The apparent dissociation constant was determined, and the effect of cations on the complex formation and the aptamer ability to inhibit the fibrinogenhydrolyzing activity of thrombin were studied. RESULTS AND DISCUSSION The complex formation of thrombin preparations with the aptamer DNA was studied using a standard technique with the use of nitrocellulose membranes. Binding isotherms were similar: higher thrombin concentrations led to a higher binding of the aptamer (Figs. 2a, 2b); however, although the achievement of plateau was affected by both the specific activity of thrombin preparation and the medium composition. For example, calcium ions did not affect the complex formation, whereas the absence of magnesium ions (ensuring the oligomer rigidity) leads to only a weak

Corresponding author; phone: +7 (095) 399-3149; e-mail: spiridon@genebee.msu.su

1068-1620/03/2905-0450$25.00 ї 2003 MAIK "Nauka / Interperiodica"


APTAMER DNA: A NEW TYPE OF THROMBIN INHIBITORS (a)
60 -18(38) 3' A A G G T G C T T C A G T G G* G15 G14 T13 G1 G2 G10 T3 T12 G11 A4 5' C A
G

451

(b )

60 -18(29) 60 -18(27)

T C C G T A9 C
8

G7 G
6 5

G

233 241 ...RLKKWIQKVIDQFGE

Fig. 1. (a) A model of the tertiary structure of the complex thrombin (dark band)-aptamer DNA (light band) and (b) the secondary structure of the DNA aptamer. An arrow shows the contact found by the method of covalent chemical binding [18].

interaction of the aptamer with proteins (data not shown). The absence of potassium ions also increases the apparent dissociation constant (Fig. 2b), because potassium ions probably stabilize the G quartet aptamer structure. In fact, NMR studies of these structures in various buffers showed that potassium ion could be incorporated into G quartets and stabilize them [16]. This implies that the rigidity of the oligomer spatial structure (Fig. 1b) is the determining factor at its interaction with thrombin. The efficiency of the formation of aptamer DNA- thrombin complex also strongly depends on the specific activity of the enzyme preparation. In the medium that is optimal for maintaining the aptamer structure (Fig. 2a), a fourfold increase in the specific activity of thrombin preparation (from 1200 to 4500 U/mg) results in a nearly 30-fold increase in its binding (Kd(app) = 160 + 6.9 and 5.6 + 1.9 nM, respectively). Without potassium ions, this difference is smaller ((Kd(app) = 273 + 54.3 and 135 + 27 M, respectively) (Fig. 2b). However, the more active preparation is bound more effectively in both cases. The formation of the aptamer DNA-thrombin complex causes an inhibition of fibrinogen-hydrolyzing activity of the enzyme in a model buffer system (Fig. 3). An increased substrate concentration induces a nearly proportional increase in the aptamer concentraRUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY

tion required for 50% inhibition of the initial enzyme activity. Preliminary experiments on the aptamer inhibition of blood serum coagulation induced by thrombin showed similar results: an increase in the concentration of the aptamer-thrombin complex resulted in a longer time of fibrin formation. To conclude, we should stress that various commercial preparations of thrombin demonstrated different abilities to form the complex with the aptamer DNA. This opens new opportunities for the aptamer use in clinical practice as thrombin inhibitors of a new type. EXPERIMENTAL The thrombin preparations with the activities of 1200 NIH units/mg (NPO RENAM, Russia) and 4500 NIH units/mg (Tekhnologia-standard, Russia) were used. Fibrinogen was from Bakpreparaty company (Lithuania). The salts and buffer components were at least of the reagent grade purity. The oligonucleotide (aptamer) was synthesized on an automatic AP-380B synthesizer. The radioactively labeled aptamer was prepared by phosphorylation using polynucleotide kinase and [-32к]ДнP and purified by electrophoresis in 8% PAG in the presence of 8 M urea (the specific activity of approximately 40 000 cpm per pmol). Radioactivity was measured according to the Cherenkov method; the optical absorption of aptamer DNA solutions was
No. 5 2003

Vol. 29


452 Portion of bound DNA 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0 1000 2000 3000 [Thrombin], nM 4000 2 100 200 300 (b ) 400 500 600 1

SPIRIDONOVA et al.

() 2

700

1

determined at 260 nm. Its solutions were prepared in 20 mM Tris-acetate buffer (pH 7.4) containing 1 mM MgCl2, 1 mM CaCl2, 140 mM NaCl, and 5 mM KCl (buffer A) or 1 mM MgCl2 and 100 mM NaCl (buffer B). The aptamer DNA-thrombin complex formation. The DNA preparation was denatured at 90њл followed by rapid cooling in ice according to standard protocols. Equal volumes of the enzyme and aptamer solutions were incubated at 37њл for 30 min (the time of reaching the equilibrium). The aptamer and thrombin concentrations were varied from 0 to 700 and from 0 to 3500 nM, respectively; the medium was either buffer A or B. The efficacy of complex formation was determined according to the standard procedure by filtering through nitrocellulose membranes Hybond-C, 0.45 чm (Amersham). The membrane radioactivity was measured according to the Cherenkov method. The calculation of apparent dissociation constants was performed by plotting thrombin-aptamer DNA binding isotherms in the Scatchard coordinates. The activity of thrombin preparations was determined by monitoring fibrinogen hydrolysis (37њC) using a Fibrintimer coagulometer (Behring, Germany). The reaction mixture (200 чl) contained equal volumes of a 19-38 чM substrate solution and the enzyme preparation in buffer A. ACKNOWLEDGMENTS The authors are grateful to A.L. Berkovsky for a kind gift of the preparations; N.I. Larionova for fruitful discussions and remarks; and T.I. Rassokhin and S.I. Bessonov for the help in preparation of the manuscript. The work was supported by the Russian Foundation for Basic Research, project no. 01-04-48603; by the program Universities of Russia, project no. 05.03.007; and by International Gorbachev Foundation. REFERENCES
1. Gold, L., Polisky, B., Uhlenbeck, O., and Yarus, M., Annu. Rev. Biochem., 1995, vol. 64, pp. 763-797. 2. Gold, L., J. Biol. Chem., 1995, vol. 270, pp. 13 581- 13 584. 3. Osborne, S.E., Matsumura, I., and Ellington, A.D., Curr. Opin. Chem. Biol., 1997, vol. 1, pp. 5-9. 4. Kopylov, A.M., Spiridonova, V.A., and Park, K.-Kh., Ross. Khim. Zh., 1998, vol. 42, pp. 89-96. 5. Kopylov, A.M. and Spiridonova, V.A., Mol. Biol. (Moscow), 2000, vol. 34, pp. 1097-1113. 6. Tuerk, C. and Gold, L., Science, 1990, vol. 249, pp. 505- 510. 7. Takeno, H., Yamamoto, S., Tanaka, T., Sakano, Y., and Kikuchi, Y., J. Biochem. (Tokyo), 1999, vol. 125, pp. 1115-1119.
Vol. 29 No. 5 2003

Fig. 2. Isotherms of DNA aptamer binding to various thrombin preparations with the activities of (1) 1200 and (2) 4500 NIH units/mg in (a) buffer A and(b) buffer B. The aptamer DNA concentration was (1) 40.5 and (2) 27.5 nM.

Activity, % 110 100 90 80 70 60 50 40 30 0 3 100 200 300 400 500 600 700 800 [Aptamer], nM 2 1

Fig. 3. Inhibition of the thrombin fibrinogen-hydrolyzing activity by the DNA aptamer. The concentration of the thrombin preparation with the activity of 4500 NIH units/mg was 15 nM; the substrate concentration was (1) 19, (2) 30, and (3) 38 чM.

RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY


APTAMER DNA: A NEW TYPE OF THROMBIN INHIBITORS 8. Takeno, H., Tanaka, T., and Kikuchi, Y., Nucl. Acids Symp. Ser., 1997, vol. 37, pp. 249-250. 9. Fukuda, K., Vishnuvardhan, D., Sekiya, S., Hwang, J., Kakiuchi, N., Taira, K., Shimotohno, K., Kumar, P.K., and Nishikawa, S., Eur. J. Biochem., 2000, vol. 267, pp. 3685-3694. 10. Bless, N.M., Smith, D., Charlton, J., Czermak, B.J., Schmal, H., Friedl, H.P., and Ward, P.A., Curr. Biol., 1997, vol. 7, pp. 877-880. 11. Charlton, J., Sennello, J., and Smith, D., Chem. Biol., 1997, vol. 4, pp. 809-816. 12. Charlton, J., Kirschenheuter, G.P., and Smith, D., Biochemistry, 1999, vol. 36, pp. 3018-3026. 13. Panchenko, E.P. and Dobrovol'skii, A.B., Trombozy v kardiologii. Mekhanizmy razvitiya i vozmozhnosti terapii (Thromboses in Cardiology: Mechanisms of

453

14. 15. 16.

17.

18.

Development and Possibilities of Therapy), Moscow: Sport i Kul'tura, 1999, pp. 55-74. Machovich, R., The Thrombin, Boca Raton: CRP Inc., 1984, vol. 1, pp. 131-160. Bock, L.C., Griffin, L.C., Latham, J.A., Vermaas, E.H., and Toole, J.J., Nature, 1992, vol. 355, pp. 564-566. Macaya, R.F., Waldron, J.A., Beutel, B.A., Gao, H., Joesten, M.E., Yang, M.M., Patel, R., Bertelsen, A.H., and Cook, A.F., Biochemistry, 1995, vol. 34, pp. 4478- 4492. Tsiang, M., Gibbs, C.S., Griffin, L.C., Dunn, K.E., and Leung, L.L., J. Biol. Chem., 1995, vol. 270, pp. 19 370- 19 376. Tasset, D.M., Kubik, M.F., and Steiner, W., J. Mol. Biol., 1997, vol. 272, pp. 688-698.

RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY

Vol. 29

No. 5

2003