... All-Union Topological conference, Tashkent, Report on dimension of groups with left invariant topology. ... International mathematical Congress, Nice, invited lecture ''Extraordinary homology theories: bordisms and K--theory'' . ... All-Union Topological conference, Tbilisi, lecture on homotopy invariants of non simply-connected manifolds. ... Topological conference, Minsk , lecture on hermitian K--theory. ... International topological conference, Moscow, lecture on Banach algebras and K--theory. ...

Еще в разделе: (Показать все результаты (>145) - higeom.math.msu.su/ )

• Conferences (English)
• Taras Panov (English)
• Old conferences (English)

NATO Advanced Research Workshop . ... From theory to practice . ... Dear NATO-ARW Participants and NATO-Book Contributors: . ... This is a concluding infoletter on the NATO-ARW "Use of humates to remediate polluted environments: from theory to practice". ... The scientific output of the ARW as a whole is to be accomplished with issuing a book: "Use of humic substances to remediate polluted environments: from theory to practice" as a NATO ASI SERIES VOLUME, Kluwer Academic Publishers, Dordrecht. ...

Еще в разделе: (Показать все результаты (>96) - mgumus.chem.msu.ru/ )

• Seminar 11 December 2002
• Seminar 19 December 2002
• IHSS-14

Open Conference Systems . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... January February March April May June July August September October November December 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 . ... By default only papers containing all terms in the query are returned (i.e., AND is implied) . Combine multiple words with OR to find papers containing either term; e.g., education OR research . ...

Еще в разделе: (Показать все результаты (>13) - hea.phys.msu.su/ )

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>6400) - hist.msu.ru/ )

• Шукуров Рустам Мухаммадович. Публикации

. Pictures from Italy! .

Еще в разделе: (Показать все результаты (>37) - cellmotility.genebee.msu.ru/ )

... Prof., Dr. Sci. Phys.-Math.) ...

Еще в разделе: (Показать все результаты (>60) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika History
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011

Вы посетили: activ_engl.html . ... История кафедры . ... Editor of the special issue of the journal Linear Algebra and its Applications devoted to Idempotent and Tropical Mathematics, 2010 . Editor of the journal Fundamental and Applied Mathematics . ... Linear Algebra and its Applications . Linear and Multilinear Algebra . ... Electronic Journal of Linear Algebra . ... staff/guterman/activ_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>20) - halgebra.math.msu.su/ )

• staff:guterman:inv_engl.html | Кафедра высшей алгебры
• staff:guterman:activ_rus.html | Кафедра высшей алгебры
• staff:arzhantsev_publications | Кафедра высшей алгебры

... Course work . Practical work . ... Head of chair: . ... About chair . ... Coherent Optics Laboratory . Synchrotron Radiation Laboratory . Nanosystem physics laboratoryљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљ . Fiber-optic communication laboratory . ... Chair history . ... Head of chair, professors and PhD biographies . ... August 21, 2014 . 22 июля 2014 г. приказом ректора МГУ академика В.А. Садовничего . ...

Еще в разделе: (Показать все результаты (>2) - optics.phys.msu.ru/ )

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>21) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

announces . seminars & conferences . Zelmanov' seminar . scientific & engineering staff . students & postgraduates . useful links . projects . articles . catalogs & databases . algorithms & programming . 1 mas (отчет о первой астрометрической школе) . Труды ГАИШ . history of Moscow astronomical observatory . photo gallery . miscellaneous . Some pages are now in Russian only. editor valera , . librarian gribko .

Еще в разделе: (Показать все результаты (>18) - astrometric.sai.msu.ru/ )

• Baksan

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>143) - monkey.belozersky.msu.ru/ )

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

• Laboratory of Mechanics of Multiphase Media: Archive 2010

... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...

Еще в разделе: (Показать все результаты (>33) - eng.geogr.msu.ru/ )

• Department of Social-Economic Geography of Foreign Countries

... People . ... Photogallery: Chirinda, Evenkia, July-August 2007 . ... A house where people live . ... Valentina Khristoforovna Yoldogir . ... Audio recording the Evenki word list: the young people are working (Yulia Kombagir and Ilia Yoldogir, Ilia’s brother Misha listening) . ... Valentina Khristoforovna Yoldogir watching the video recording of her telling an Evenki fairy tale . ... Valentina Khristoforovna Yoldogir is telling an Evenki fairy tale to us and to her grandchildren sitting in the tent ....

Еще в разделе: (Показать все результаты (>28) - lcl.srcc.msu.ru/ )

Time and its physical relationships Andrew Michrowski President, The Planetary Association for Clean Energy, Inc., ... Time is a factor of energy. ... Volume 35 (8), August, 1982. p. 45 -7. ... Volume 1 and 2. ... Wiley, New York 1992, 1993, 1997, and 2001] Volume 85 (2). ... Time and causal mechanics Since time is the result of movement of energy (and accordingly, light), then time is associated with the cause-effect processes linked to a first position of energy to the next. ... New Energy News. ...

Еще в разделе: (Показать все результаты (>366) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/seminar/new_program_eng.pdf
• ИНФОРМАЦИОННОЕ ПИСЬМО
• Table 1

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . news . Panasyuk M. (SINP, Russia). Relec . Klimov S. (ISR, Russia). Wave Research... (SINP, Russia). Relec 1th results . Bogomolov V., Iudin A. (SINP, Russia). Relec TGF-GRB . Bogomolov A., Myagkova I. (SINP, Russia). Hi-energy electrons research...

Еще в разделе: (Показать все результаты (>2) - vernov-relec.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>95) - srcc.msu.ru/ )

• V.N. Lykossov, V.N. Krupchatnikov. Dynamic Meteorology. // In: Russian National
• Conferences
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )