... Effect of mutations mimicking phosphorylation on the structure and properties of human 14-3-3zeta. ... Effect of mutations mimicking phosphorylation on the structure of human 14-3-3zeta protein was analyzed by different methods. Mutation S58E increased intrinsic Trp fluorescence and binding of bis-ANS to 14-3-3. ... Thus, mutation mimicking phosphorylation of Ser58 destabilized, whereas mutation of Ser184 induced stabilization of 14-3-3zeta structure. ...

Еще в разделе: (Показать все результаты (>51) - biochem.bio.msu.ru/ )

• Structure, properties, and probable physiological role of small heat shock
• Structure and properties of K141E mutant of small heat shock protein HSP22
• Structure, properties, and functions of the human small heat-shock protein

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... User account . Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Language settings . Language . ... This account's default language for e-mails. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation

... News . ... Lost Username Lost Password . If you lost your username , please enter your E-mail Address, then click the Send Username button, and your username will be sent to your email address. If you forgot both your username and your password , please recover the username first, then the password. ... If you lost your password but know your username, please enter your Username and your E-mail Address, press the Send Password button, and you will receive a new password shortly. ...

Еще в разделе: (Показать все результаты (>12) - engineering.phys.msu.ru/ )

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ­ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>24) - analyt.chem.msu.ru/ )

• Ссылки для изучения студентам, предполагающим делать курсовую работу в группе

Schedule : Nonlinearity of Media and Structures, Nonlinear Testing . ... Guyer R. (invited) . ... Esipov I. B. Nonlinear Sound Wave Propagation in 2-D Hysteretic Medium . ... Berndt T. P. Simultaneous Probing of the Nonlinear Effect of a Plane Unbonded Interface on Incident Longitudinal and Shear Acoustic Waves as a Function of Amplitude and Pressure . ... R. E. (invited) . ... Korobov A. I. Influence of Internal Structure of Polycrystalline Copper on Its Nonlinear Elastic and Acoustic Properties . ...

Еще в разделе: (Показать все результаты (>136) - acs366.phys.msu.su/ )

• Nonlinearity of Media and Structures, Nonlinear Testing
• Abstract

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>13) - hcs.cmc.msu.ru/ )

• Master program "Network Software" | Магистерское и послевузовское образование
• User account | Магистерское и послевузовское образование

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>7) - lcl.srcc.msu.ru/ )

... A.V. Chetvertukhin, M.I. Sharipova, A.G. Zhdanov, T.B. Shapaeva, T.V. Dolgova, and A.A. Fedyanin . ... A. I. Musorin, P. V. Perepelkin, M. I. Sharipova, A. V. Chetvertukhin, T. V. Dolgova, and A. A. Fedyanin . ... Margarita I. Sharipova, Alexander I. Musorin, Tatyana V. Dolgova, Andrey A. Fedyanin . Ultrafast dynamics of Faraday rotation in thin films" . ... Sharipova M.I., Musorin A.I., Dolgova T.V., Inoue M., Fedyanin A.A. "Ultrafast Dynamics of Faraday Rotation in Magnetophotonic Crystals" . ...

Еще в разделе: (Показать все результаты (>200) - nanolab.phys.msu.ru/ )

• User account | Laboratory of Nanophotonics & Metamaterials
• User account | Лаборатория нанооптики и метаматериалов
• Static and ultrafast nonlinear optics of metamaterials | Laboratory of

. 1< 2 3 4 5 6 7 8 .

Еще в разделе: (Показать все результаты (>374) - chronos.msu.ru/ )

• Laboratory-chair of Discrete mechanics on a microscopic scale
• Laboratory-chair of causal mechanics
• On the Way to Understanding the Time Phenomenon: the Constructions of Time in

. Advanced Study Institute "Structure and Dynamics of Elementary Matter", . Kemer, Turkey, September 21 - October 2, 2003 . To Hadronic Interactions Laboratory Home Page . To Igor Lokhtin Home Page . Last update: October 3, 2003, Igor Lokhtin

Еще в разделе: (Показать все результаты (>42) - lav01.sinp.msu.ru/ )

• Home Page of L. Sarycheva
• Home Page of I. Lokhtin
• Home Page of A. Demianov

: «SAP HANA ­ the main memory database platform for modern hardware» «SAP HANA ­ » 23 2013 . 18.30 : Franz Faerber, : - SAP SAP HANA (High-Performance Analytics Appliance) ­ , . «in-memory» SAP . , SAP HANA «in-memory» , , . SAP HANA , SAP HANA, SAP Labs . : Franz Faerber, SAP 1994 ., - SAP. SAP HANA, . : . .. , (2- ), . -8 ! 22 : mag-prog@lvk.cs.msu.su http://erp.cmc.msu.ru/ 247, : +7 (495) 939-55-68

77. ASTROMETRY DEPARTMENT of SAI

78. Space Scientific and Education project of Lomonosov Moscow State University

79. 3d structure

80. http://lms.cs.msu.su/