... Authors: Mark J. Reid et al. arxiv:1106.3079 Рост черных дыр в молодой вселенной саморегулируется и существенно скрыт от взоров (Black hole growth in the early Universe is self-regulated and largely hidden from view) . ... Authors: Y. Muraki et al. arxiv:1106.1355 Первое наблюдение оптических пульсаций от источника мягких повторяющихся гамма-всплесков: SGR 0501+4516 (The first observation of optical pulsations from a soft gamma repeater: SGR 0501+4516) . ...

Еще в разделе: (Показать все результаты (>104) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1212.html
• http://xray.sai.msu.ru/~polar/sci_rev/2002-07_2003_03/reduce.html
• Astronomy links

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

Аномалии полового развития амфипод Gammarus pulex (L.), найденных ниже станции для очистки сточных вод. ... С. 1792-1797. ... У самцов амфипод, обитающих ниже очистных сооружений в графстве Суррей (Великобритания), строение гонад, наружные половые признаки и размеры тела были такими же, как на контрольном участке. У самок значительно нарушалась структура ооцитов в вителлоегенезе. Одновременно уменьшалась длина тела самок и отношения размера самцов к размеру самок по сравнению с контролем. ...

Еще в разделе: (Показать все результаты (>5) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207100038
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=30&from=0&ref_ind=0209000194
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=7&subtheme=30&from=&ref_ind=0411001821

Some remarks about QGP study in HI collisions Federico Antinore, lecture "From Hevy ion to Quark Matter"; L. McLerran Relativistic heavy-ion physics: three lectures W. Florkowski "Ultra-relativistivc heavy ion collisionbs"

Еще в разделе: (Показать все результаты (>14) - lav01.sinp.msu.ru/ )

... Fursikov Andrei Vladimirovich . Head of the Department . ... Navier-Stockes equations, statistical hydrodynamics, theory of control for systems with distributed parameters. student of Mark Iosifovich Vishik . ... He is a member of the editorial board of "Journal of Dynamical and Control Systems", "Journal of Mathematical Fluid Mechanics", "Interdisciplinary Math. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>13) - new.math.msu.su/ )

• Demidov Aleksandr Sergeyevich | Department: General Problems of Control.

... An event inexplicable by the laws of nature; a miracle. ... A good title for the workshop · Dark matter came as a surprise, · A strong emotion is associated with the awareness that we seem to know the basic laws of nature but we still miss... what is the universe made of.. Raises doubts on our understanding of early universe · Its discovery may need a monumental effort · BUT, hopefully it CAN be explained by the laws of nature Progress on DM · Evidence from Dama/Lybra .. ...

Еще в разделе: (Показать все результаты (>58) - nuclphys.sinp.msu.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Geography . ... 29 Feb 2016 . ... Head of Department of Economic and Social Geography of Russia, Chair of Commitee of Scientific and Research work, Doctor of Geography. ... Prof. Alexandr Gennadiev - Deputy Head of Department of Landscape Geochemistry and Soil Geography, Doctor of Geography. Prof. Kirill Dyakonov - Head of Department of Physical Geography and Landscape Science, Corresponding Member of Russian Academy of Sciences, Doctor of Geography. ...

Еще в разделе: (Показать все результаты (>4) - conf.msu.ru/ )

ANCIENT AND EARLY MEDIEVAL ECLIPSES IN EUROPEAN SOURCES . ... J.K.Fotheringham, A Solution of Ancient Eclipses of the Sun, Mon. ... R.R.Newton, Ancient astronomical observations and the acceleration of the earth and moon, The Johns Hopkins University Press, 1970 (R.R.Newton, 1970) . ... F. R. Stephenson, Historical Eclipses and Earth's Rotation, Cambridge University Press, 1997. ... Plutarch, "Romulus" . ... The solar eclipse observed by the poet Archilochus . ... The eclipse observed by Plutarch . ...

Еще в разделе: (Показать все результаты (>73) - hbar.phys.msu.ru/ )

• CHAPTER VI
• Critical remarks
• Michael L. Gorodetsky

. Помощь - Поиск - Пользователи - Календарь . Полная версия: Пожарный дозор . Грация-МГУ::Форум > Мультимедия > Видео . O'Rey . Dec 19 2006, 13:14 . http://iiv.gallery.ru/videos/2272.html . Artem . Dec 19 2006, 14:50 . Смешно =) . AleXP . Dec 19 2006, 16:41 . оттуда же :) . Вот так играют в футбол пацаны ! ^_^ . http://petrovich.gallery.ru/videos/2497.html . Это текстовая версия - только основной контент. Для просмотра полной версии этой страницы, пожалуйста, нажмите сюда .

Еще в разделе: (Показать все результаты (>18) - grace.msu.ru/ )

• Грация-МГУ::Форум > Ищу суппер партнера!
• Ищу суппер партнера! - Грация-МГУ::Форум
• Пожарный дозор - Грация-МГУ::Форум

... MRAM). ... 14.1, IBM, . 2006 3.5 200 , , 2004 - 100 . 14.1. ... 14.5. (bit length) (bit width) . ... 100 . ... LIMDOW (Light Intensity Modulated Direct OverWrite - ). LIMDOW- , . LIMDOW 100% . ... MRAM - magnetic/magnetoresistive random access memory) , , , , . MRAM, RAM(Random Access Memory). ... MRAM RAM (SRAM) RAM (DRAM) - RAM, . ... bit lines) (word lines) ( . ... MRAM IBM, , Siemens, Motorola, Philips, Hewlett Packard, Hitachi. ... Motorola 1 Mb MRAM, [2]. ...

Еще в разделе: (Показать все результаты (>39) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/MagNanoS/L9.pdf
• http://danp.sinp.msu.ru/LIIWM/Nimb258_may07_109Mashkova.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-3.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out

. HOME . MSU Chamber Orchestra . ИМЕЕТСЯ РУССКАЯ ВЕРСИЯ . The Musical Workshop . of Edward Gindin . To see Edward Gindin's painting, . visit his gallery .

Еще в разделе: (Показать все результаты (>6) - music.genebee.msu.ru/ )

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>3) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization

... Bachelor Program . Master Program . ... The Department of Operations Research . ... researchers specialized in mathematical models and methods of economic regulations . ... possess a profound knowledge in the field of e со nometrics, risk theory, actuarial and financial mathematics, the theory of games, operations research, economic regulation on micro and macro levels . ... can use modern computer technologies in order to construct models and solve optimization problems . ... exam . ... test . ...

Еще в разделе: (Показать все результаты (>4) - io.cmc.msu.ru/ )

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>9) - belyakov.imec.msu.ru/ )

Experimental Study of the Acoustic Field Generated by a 50 MeV Electron Beam in Water V. B. Bychkov1, V. S. Demidov2, E. V. Demidova2, A. N. Ermakov3, O. D. Ershova3, B. S. Ishkhanov3, V. P. Maslyany1, A. Yu. ... At a two-dimensional diagram (distance-time) two signal tracks were observed from two sound sources: a cylindrical acoustic antenna generated by the electron beam, and an area of the beam entrance cap which divides the water medium from the air. ... Fig. ... Arrows mark the beam spill time. ...

Еще в разделе: (Показать все результаты (>6) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/MAM%202011%20-%20Volodya.pdf
• http://antares.sinp.msu.ru/docs/Kulikovsky%20-%20NEMO&ANTARES.pdf

... Кафедры . ... В конференции принимали участие студенты философского и филологического факультетов и факультета иностранных языков и регионоведения. 12 ноября в рамках конференции на факультете иностранных языков и регионоведения прошло заседание со студентами 3 курса отделения лингвистики и межкультурной коммуникации на испанском языке. ... Факультет иностранных языков и регионоведения МГУ имени М.В. Ломоносова . ... 2000 - 2016 Факультет иностранных языков и регионоведения МГУ имени М.В. Ломоносова...

Еще в разделе: (Показать все результаты (>29) - ffl.msu.ru/ )

A Short Course in Differential Geometry and Topology A.T. Fomenko and A.S. Mishchenko sP A Short Course in Differential Geometry and Topology A.T . ... Partition of Unity 2.4.1 Functional separability 2.4.2 Partition of unity 3 CONTENTS 51 52 54 Smoot h Manifolds (General Theory ) 57 3.1 Concept of a Manifold 59 3.1.1 Main definitions 59 3.1.2 Functions of change of coordinates. ... Frenet formulae 4.1.2 Theory of spatial curves. ... Examples and illustrations are included throughout the chapter. ...

Еще в разделе: (Показать все результаты (>49) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/garber/talks/2012Moscow.pdf

. С 25 октября по 7 декабря 2012 года . Выход в город . Мемориальная квартира Андрея Белого участник просветительского проекта Департамента культурного наследия Москвы Выход в город . Информацию о проекте см. здесь: . http://vihod-v-gorod.ru/programm/index.php?filterDate=&filterProgramm=14154&filterFormat=&filterGuide = , . https://www.facebook.com/vihodvgorod , http://vihod-v-gorod.ru/gallery/30417/ . Запись на экскурсии в музей на сайте программы Выход в город : http://vihod-v-gorod.ru/about/kontakty/ .

Еще в разделе: (Показать все результаты (>3) - kvartira-belogo.guru.ru/ )

International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership (February 29 ­ March 2, 2016 Bishkek, Kyrgyz Republic ) Day 1 (February 29, Monday) 08:30 09:00 Official Opening Session Chair: Dr. Sergey Shoba, Director of Eurasian Center for Food Security at Lomonosov Moscow State University 09:00 ­ 09:45 Welcoming remarks by: a) Representative of the Kyrgyz Government (Bekboev Turdunazir ...

Еще в разделе: (Показать все результаты (>4) - ecfs.msu.ru/ )