Wavelet Analysis of E852 Experimental Data V. L. Korotkikh  and L. I. Sarycheva   Scobeltsyn Institute of Nuclear Physics, Moscow State University, Moscou 119899, Russia Abstract. A calculation of background in the hp 0 mass spectrum by the wavelet analysis is presented. ... A large final state statistics of E852 experiment [4, 5, 6] in the p p interactions at 18 GeV/c allows to use the wavelet analysis both for one­dimensional and for two­ dimensional distributions. ... are built (fig. ...

Еще в разделе: (Показать все результаты (>44) - lav01.sinp.msu.ru/ )

Russian Math . ... Nauk 70:6 203­212 COMMUNICATIONS OF THE MOSCOW MATHEMATICAL SOCIETY Equations of motion of non-holonomic systems A. V. Borisov and I. S. Mamaev We consider a non-holonomic mechanical system whose configuration space is some (smooth) manifold N . ... In order to explicitly write the vector field on M defined by (1), we choose in each tangent space to T Nq a new basis of vector fields (q), = 1, . ... n), then the equations of motion are represented in the pseudo-Hamiltonian form. ...

Еще в разделе: (Показать все результаты (>131) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...

Еще в разделе: (Показать все результаты (>15) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc

... Бережной А.А., Клумов Б.А., Фортов В.Е., Шевченко В.В. Письма в ЖЭТФ, Т. 63, N6, С. 387-391, 1996 . ... A. A. Berezhnoy1,2, N. Hasebe1, M. Kobayashi1, G. Michael3 and N. Yamashita1 1Advanced Research Institute for Science and Engineering, Waseda University, Tokyo, Japan 2Sternberg Astronomical Institute, Moscow, Russia 3German Aerospace Center, Institute for planetary research, Berlin, Germany . Brown University - Vernadsky Institute Microsymposium 40, 2004, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>70) - selena.sai.msu.ru/ )

• Aleksei A. Berezhnoi

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>19) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E15_Nosov_Kolesov.pdf
• http://seac47-2.phys.msu.ru/proc/E22_Watts.pdf

Title Author Key words Clinical perspective on social inequalities Masalkov I.K critical sociology, clinical approach, social pathology, paradoxical messages, schizophrenic behavior, fear, shame, anger Social inequality refers to relational processes in society. In article are considered specific features of the degradation of social relations in different areas. ... Economic approach considers features of the distribution of wealth and income. ... Abstract ...

Еще в разделе: (Показать все результаты (>48) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/2/17.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/2/01.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/2/09.pdf

... Projectile proton energies are above 300 keV Scattering angles are of fractions of mrad . ... C.D. Lin) FBA Exact representation of the amplitude so called paraxial approximation for fast proton Exact representation of the amplitude Basis for SBA and EWBA Integral representation of EWBA (eikonal) Integral representation of the FBA CALCULATIONS: Charge transfer Hong-Keun Kim et al Phys . Rev. A 85, 022707 (2012) Powerful note All helium wave functions, both ... Phys. Rev. A 71 (2005), 12706. ...

Еще в разделе: (Показать все результаты (>9) - lmmqsp.sinp.msu.ru/ )

• http://lmmqsp.sinp.msu.ru/mat/posterTE_Mongolia.pdf
• http://lmmqsp.sinp.msu.ru/mat/present_ICPEAC_popov.pdf
• http://lmmqsp.sinp.msu.ru/mat/popov_dubna2013.pdf

... Probable participation of 14-3-3 in tau protein oligomerization and aggregation. ... This review is focused on universal adapter proteins 14-3-3 that seem to be significant partners to tau protein in neurons. 14-3-3 interacts with nonphosphorylated tau and promotes its interaction with and phosphorylation by a number of protein kinases. 14-3-3 induces aggregation of nonphosphorylated tau and does not affect aggregation of tau phosphorylated at specific sites. ...

Еще в разделе: (Показать все результаты (>13) - biochem.bio.msu.ru/ )

• The effects of endogenous non-peptide molecule isatin and hydrogen peroxide on
• [The use of immobilized ubiquitin for biosensor analysis of the mitochondrial

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>6) - www.pereplet.ru/ )

... Molecular Mechanics Calculations of beta-Diketonate, Aqua, And Aqua-beta-Diketonate Complexes of Lanthanide Ions Using Gillespie-Kepert Model . ... Abstract - A version of molecular mechanics based on the Gillespie-Kepert model of coordination bonds "repulsion" is applied to lanthanide complexes. ... For the aqua complexes, typical root-mean-square deviation (calculated vs. ...

Еще в разделе: (Показать все результаты (>26) - analyt.chem.msu.ru/ )

• Molecular mechanics study of the mixed-ligand lanthanide complexes using

The dynamics of binary alternatives for a discrete pregeometry arXiv:1201.0005v1 [gr-qc] 28 Dec 2011 Alexey L. Krugly Abstract A particular case of a causal set is considered that is a directed dyadic acyclic graph. ... Each vertex possesses two incident incoming edges and two incident outgoing edges. ... There are two types of external edges: incoming external edges and outgoing external edges. ... The number n of incoming or outgoing external edges is not changed by this elementary extension. ...

Еще в разделе: (Показать все результаты (>13) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_an-example.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_a-sequential-growth.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_discreet-mechanics.pdf

... Clarification of Binding of MPI_TYPE_SIZE . Up: MPI-1.0 and MPI-1.1 Clarifications Next: Clarification of MPI_REDUCE Previous: Clarification of MPI_INTERCOMM_MERGE . This clarification is needed in the MPI-1 description of MPI_TYPE_SIZE, since the issue repeatedly arises. It is a clarification of the binding. Advice to users. The MPI-1 Standard specifies that the output argument of MPI_TYPE_SIZE in C is of type int . ... MPI-2.0 of July 18, 1997 . ... Центры . ...

Еще в разделе: (Показать все результаты (>204) - www.parallel.ru/ )

• Overview | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Comm_size | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPE_Decomp1d | PARALLEL.RU - Информационно-аналитический центр по параллельным

This module is contained in the mod_setenvif.c file, and is compiled in by default. It provides for the ability to set environment variables based upon attributes of the request. The mod_setenvif module allows you to set environment variables according to whether different aspects of the request match regular expressions you specify. ... Module: mod_setenvif . Compatibility: Apache 1.2 and above (in Apache 1.2 this directive was found in the now-obsolete mod_browser module) . ...

Еще в разделе: (Показать все результаты (>260) - rtm-cs.sinp.msu.ru/ )

• Apache module mod_expires
• Examples
• Qt Reference Documentation

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>32) - www.msm.biophys.msu.ru/ )

... This technology presumes that blood sampling is performed by patient himself, the sample is spotted on a dry, as a rule, porous surface (filter paper, cellulose acetate membrane, etc.), and the posterior transportation to a laboratory, for example, by post in a standard or a special envelope. ... Under the dried blood spot technology using, the problem of the sample spotted volume determination remains one of the main practical questions. ... The problem is to find a function f (y1 , y2 , . ...

Еще в разделе: (Показать все результаты (>127) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/TTC/slides/kamiyama.pdf
• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/2011/Mishchenko-Ribeiro-1102.5698v1.pdf
• http://higeom.math.msu.su/people/millionschikov/papers/million8.ps

... The purpose of our research was to find significant differences in island and mainland plant populations of the Russian White Sea. ... New islands were inhabited from the mainland, and as a result the population on it becomes isolated from the mainland. ... As a result the island population becomes different from the mainland populations. ... On each plant we measured about 8–12 morphological characteristics, which are known to be the most variable; 59 morphological characteristics in all. ...

Еще в разделе: (Показать все результаты (>82) - herba.msu.ru/ )

• Morphological differences of Nymphaea alba L
• Alders in the European Russia

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>43) - www.geol.msu.ru/ )

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>103) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/029e.pdf
• Intuitive Chemical Topology Concepts

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Wilson R.L. , Loh Z.M. , Wild D.A. , Bieske E.J. , Buchachenko A.A. в журнале Journal of Chemical Physics , издательство American Institute of Physics (United States) , том 121, ? ...

Еще в разделе: (Показать все результаты (>631) - istina.msu.ru/ )

• Samdal S. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Lysenko D.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Nurtdinov R.N. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического