php require('identification. php '); ? html head title Файлы пользователя ? php echo $ user ; ? /title meta http-equiv= Content-Type content= text/ html ; charset=koi8-r link rel= stylesheet href = stev_sty.css type= text/css /head body ? php echo h1 Файлы пользователя $ ... td></tr>\n"; } ?> </table></p> <?php echo "<p>На диске свободно " . ... 1024.0/1024.0/1024.0, 3) . Гбайт.</p>\n"; if(isset($clean_directory)) { echo '<p>Ваш рабочий каталог очищен. ...

Еще в разделе: (Показать все результаты (>21) - observ.pereplet.ru/ )

Authors are asked to follow the instruction to authors published in the Journal "Phytopathology" (1995, vol.85. No.l, pp.7-10) before submission a manuscript. Here is its concise translation into Russian together with the details required by this journal and those are different from "Phytopathology". Authors are urged to read very carefully all paragraphs of the instruction following below to save much unnecessary work and avoid delay in publication. ... Papers should be in English. ...

Еще в разделе: (Показать все результаты (>227) - herba.msu.ru/ )

• Systema Naturae

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>233) - www.genebee.msu.ru/ )

• The GeneBee Group
• FASTA format description
• GeneBee BLAST 2.2.22+ Services Help

Evolution and Classification of GH101 Family Glycoside Hydrolases: Four Years Later Daniil G. Naumoff S. N. Winogradsky Institute of Microbiology, Russian Academy of Sciences, Prospekt 60-letiya Oktyabrya 7/2, Moscow 117312, Russia; daniil_naumoff@yahoo.com Recent progress in geno me sequencing resulted in a rapid growth of the sequence databases. The number of known representatives of all protein families has increased dramat ically. ... This family was described in 2005 [2]. ...

Еще в разделе: (Показать все результаты (>238) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/23.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/162.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/134.pdf

Pipe Line Filtering Dmitry V. Yurin Moscow State University, Faculty of Computational Mathematics and Cybernetics, Lab. of Mathematical Methods of Image Processing. yurin_d@inbox.ru Abstract A unified template C++ library is proposed for image filtering by local environment. ... It makes easy to combine filters and transfer output of filters to input of others. ... Otherwise, each filter one time should process input and output lines with the same relative numbers in the images. ...

Еще в разделе: (Показать все результаты (>111) - imaging.cmc.msu.ru/ )

... Scientific laboratories . ... Contact information . ... nazarov@cs.msu.ru . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, room 586 . ... Introduction to mathematical analysis of financial instruments by Dr. Doynikov, 32 lecture hours, 7th semester. ... The Laboratory operates a range of special courses in mathematical finance, including ?Introduction to mathematical analysis of financial instruments? and ?Mathematical models of financial instruments?. ...

Еще в разделе: (Показать все результаты (>137) - en.cs.msu.ru/ )

• Laboratory of Statistical Analysis
• Research Laboratory of Computational Modeling Tools | CMC MSU
• Research Laboratory of Computational Modeling Tools

... Submit your article . ... Public Administration publishes scholarly articles on theory, methodology and practice of management, results of applied research projects in administration, studies of Russian and foreign administration experience, bibliographical reviews and information on conferences, round tables and workshops. ... The journal accepts polemic articles. ... All articles submitted for publication are first reviewed for compliance with the guidelines for article formatting and content. ...

Еще в разделе: (Показать все результаты (>212) - ee-journal.spa.msu.ru/ )

AN ORIGIN FOR THE SOUTH POLE-AITKEN BASIN THORIUM. ... Moscow University. ... Introduction: The lunar South Pole-Aitken (SPA) impact basin is one of the largest and oldest impact basins and has thus been heavily degraded by postbasin-formation primary impacts and their ejecta [1]. ... The SPA basin thorium map: The using data Lunar Prospector [4] the thorium distribution map demonstrated a hemisphere of the Moon which contains the SPA basin structure and its environs was constructed. ...

Еще в разделе: (Показать все результаты (>94) - selena.sai.msu.ru/ )

• Шевченко Владислав Владимирович

A Short Course in Differential Geometry and Topology A.T. Fomenko and A.S. Mishchenko sP A Short Course in Differential Geometry and Topology A.T . ... Partition of Unity 2.4.1 Functional separability 2.4.2 Partition of unity 3 CONTENTS 51 52 54 Smoot h Manifolds (General Theory ) 57 3.1 Concept of a Manifold 59 3.1.1 Main definitions 59 3.1.2 Functions of change of coordinates. ... Frenet formulae 4.1.2 Theory of spatial curves. ... Examples and illustrations are included throughout the chapter. ...

Еще в разделе: (Показать все результаты (>189) - higeom.math.msu.su/ )

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

Moscow University, Present and Future . ... I n June 1990, the Charter of M.V.Lomonosov Moscow State University was approved following extensive discussions at the Council of Learned Councils of Moscow University, comprised of the members sitting on the Learned Council of Moscow University, at the Learned Councils of the faculties and institutes and also at the councils of work collectives of the units that have no learned councils. ... Altogether the University has 300 faculty departments. ...

Еще в разделе: (Показать все результаты (>213) - hist.msu.ru/ )

• Конкурс "Моя Италия"-2010
• Исторический факультет МГУ. Образец вступительного задания
• Moscow State University. Faculty of History. Frequently Asked Questions

... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Resources for Textual Content Compression

Myotis . Uropatagium venation pattern in bats as diagnostic character (by the example of genus Myotis ) . ... By the example of genus Myotis it was shown that venation pattern on uropatagium of bats in some cases can be used as diagnostic character. Venation features on uropatagium allow easy to separate Daubentonв?Ts bat, eastern water bat, big-footed bat, and pond bat from Brandtв?Ts bat, Siberian bat, whiskered bat, and Ikonnikovв?Ts bat. ... Bats]. ... Bats of the Russian Far East]. ...

Еще в разделе: (Показать все результаты (>1425) - zmmu.msu.ru/ )

• Bird collections
• Mammal collections
• Russian Journal of Theriology

... Give an example of chemical reaction between a salt and an acid leading to the formation of another salt and a base. (1 point) [Solution] . ... Write the reactions of chromium (III) bromide with hydrogen peroxide in acidic and basic media. (2 points) [Solution] . ... In the reactions, specify the structures of all substances. (3 points) [Solution] . ... Three substances A, B, and C were mixed in the amount of three moles each. ... Example problems in chemistry for the entrance exams ( main round ) ....

Еще в разделе: (Показать все результаты (>1747) - chem.msu.ru/ )

• Псевдосимметрия и гиперсимметрия триклинных органических кристаллов
• Moscow University Chemistry Bulletin Vol. 52, No. 6, P. 443 (2011)
• Structure of the Chemistry Department of Moscow State University

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>386) - www.geogr.msu.ru/ )

• journal 'GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY'
• Сергей Сергеевич Зилитинкевич
• Вестник Московского университета. Серия 5. География

INFORMATICS IS NOT A SCIENCE. ... The modern informatics has no own theory. ... And what is a science? ... As a result with need and sufficiency it turns out that the informatics it is a science about computer automation of information operations. ... But still in objective areas of such informatics get as well operations essentially new to traditional informatics: in this case operations of measurement, control (checkout), tests, identifications, pattern recognitions, control (managements) get. ...

Еще в разделе: (Показать все результаты (>277) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc97181/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc27979/eng.pdf
• Magnetic system with regular structure

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>93) - www.intsys.msu.ru/ )

• Intelligent Systems :: Magazine :: Web archive :: Volume 17, Issue 1-4, 2013

... История кафедры . ... младших курсов . ... Уважаемые студенты 1-го, 2-го и 3-го курсов! ... Семинар кафедры проходит по пятницам в 15.20 в комн. ... а также на стендах кафедры на 2-м и 4-м этажах. Информацию о более ранних событиях см. в разделе "Жизнь кафедры" . ... 119991, Москва, Ленинские горы, д.1, стр.2, МГУ имени М.В.Ломоносова, физический факультет, кафедра фотоники и физики микроволн . ...

Еще в разделе: (Показать все результаты (>2) - photonics.phys.msu.ru/ )

... Ariskin A.A., Bouadze K.V., Meshalkin S.S., Tsekhonya T.I. (1992) INFOREX: A database on experimental studies of phase relations in silicate systems. ... Meshalkin S.S., Ariskin A.A., Barmina G.S., Nikolaev G.S., Almeev R.R. (1996) Development of a database on experimental crystal-melt equilibria for igneous rocks: INFOREX system, version-3.0. ... Meshalkin S.S., Ariskin A.A. (1996) INFOREX-3.0: A database on experimental phase equilibria in igneous rocks and synthetic systems. ...

Еще в разделе: (Показать все результаты (>941) - geo.web.ru/ )

• http://geo.web.ru/users/pavel/Publications/2004/2004.05.01.0300.Brasil.doc
• Informal geological society
• Spectrum of Heterogeneity

... Kkimiya UDC 547.821 DATABASE COVERING THE SYNTHESES OF PYRIDINE S FROM ACYCLIC REAGENTS: THE ROLE OF NONSTANDAR D RETRIEVAL REQUESTS I N DEVELOPING THE STRATEGY OF COMPUTER SYNTHESIS E. V. Babaev and S. V. Tsitovskii Th e methodolog y o f constructin g a databas e covering th e synthese s o f pyridin e ring i n a standar d ChemBas e shel l i s discussed . ... Double lines in the diagrams correspond to the skeleton bonds of the reagents that pass into the skeleton of the pyridine cycle. ...

Еще в разделе: (Показать все результаты (>173) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/030e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/023e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/028e.pdf