Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... Teaching Mathematics and its Applications: An International Journal of the IMA . ... The Australian Economic Review . ... The British Journal for the Philosophy of Science . The British Journal of Aesthetics . The British Journal of Criminology . The British Journal of Politics & International Relations . ... The Cambridge Quarterly . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>10) - wwwlib.phys.msu.ru/ )

• Библиотека физичеcкого факультета МГУ - Электронные ресурсы

Russian . Next: Reflection Up: Data Processing Functions (Mathematics Previous: Averaging by scan lines Contents Index . The averaging is fulfilled by the Command Average . The averaging is performed by standard matrix 3 3 and 5 5. The averaging by 3 3 matrix is available through the button on the Tool Bar. Russian . Next: Reflection Up: Data Processing Functions (Mathematics Previous: Averaging by scan lines Contents Index Filonov 2005-02-04

Еще в разделе: (Показать все результаты (>77) - www.spm.genebee.msu.ru/ )

• Differential filters
• Morphological Filters

TEACHING MATHEMATICS BY USING WEBMATHEMATICA Vorob'ev E.M., Nikishkin V.A. Moscow State University of Economics, Statistics and Informatics Institute of Computer Technologies, Higher Mathematics Chair Building 7, Nezhinskaya str., ... So Mathematica is mainly intended for full-time students while webMathematica being on-line system can serve as a basis for distant education. Teaching by using webMathematica relies on interactive electronic tutorials developed by the authors. ...

Еще в разделе: (Показать все результаты (>238) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc60875/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc173938/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc27979/eng.pdf

News . News Archive . ... SUNY @ Albany Delegation from the Department of Mathematics and Statistics headed by the Dean E. Turner including prof. B. Goldfarb and prof. K. Zhu. ... Do not leave without exploring our News Archive . ... suny-msu . ...

Еще в разделе: (Показать все результаты (>13) - suny.msu.ru/ )

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Еще в разделе: (Показать все результаты (>13) - lcc.chem.msu.ru/ )

. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .

Еще в разделе: (Показать все результаты (>7) - acm.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... Inverse problems in mathematical physics . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>9) - math.phys.msu.ru/ )

Автор: Юрий Тукачев . ... Официальные русскоязычные руководства пользователя по IBM SPSS Statistics 20 (в формате PDF): . Руководство пользователя по базовой системе IBM SPSS Statistics 20 . Руководство пользователя по функционалу базового модуля IBM SPSS Statistics Base 20 . ... Руководства пользователя на русском языке по IBM SPSS Statistics 20 . ... Флогистон / психологический блог / Руководства пользователя на русском языке по IBM SPSS Statistics 20 . ... 2 Константин Ефимов . ...

Еще в разделе: (Показать все результаты (>170) - www.flogiston.ru/ )

• факторный анализ

... Главная . ... О кафедре . ... Здесь Вы можете получить самую разнообразную информацию о кафедре, ее сотрудниках, курсах лекций, познакомиться с историей кафедры. ... Числовые и нечисловые поля. 24 сентября в 15.20 состоится заседание -- научный семинар кафедры математики. ... Студентов младших курсов: информация о кафедре, темы курсовых работ.. Сотрудников кафедры: описание курсов, материалы (задачи, контрольные вопросы) .. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>11) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ­ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

... The data about the species pattern of the lake flora were collected. During summer biological practics and expeditions of Moscow Gymnasium on Southwest, which took place in the Thupa region, at Tchupa gulf of the White Sea, and in Udomelsky region, of Tverskaya province, near the lake Moldino, since 1999 till 2001. 17 lakes of the Tchupa gulf environ and 4 lakes of Tverskaya province were studied. ... We designed a method of studying selected blocks for the description of flora. ...

Еще в разделе: (Показать все результаты (>155) - herba.msu.ru/ )

• Index of /shipunov/school/biol_240/en

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... The University Information System RUSSIA (UIS RUSSIA) has been designed and is maintained as a corporate digital library for research and education in economics and social sciences. ... The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>105) - srcc.msu.ru/ )

• Moss D., Kitchatinov L.L., Sokoloff D., Reversals of the solar dipole, eprint
• Presentations and Lectures
• Sokoloff Dmitry CV

... Laboratory of Mathematical Methods of Image Processing . ... Image analysis . ... Ringing effect . ... It can be efficiently used as a post-processing method for global image deblurring methods . ... Development of edge width estimation algorithm is important for image enhancement and image quality analysis methods. ... Ringing effect so known as Gibbs phenomenon in mathematical methods of image processing is the annoying effect in images and video appeared as rippling artifact near sharp edges. ...

Еще в разделе: (Показать все результаты (>624) - imaging.cmc.msu.ru/ )

• Laboratory of Mathematical Methods of Image Processing
• Image resampling and superresolution | Laboratory of Mathematical Methods of
• Software projects | Laboratory of Mathematical Methods of Image Processing

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )