... Processing of pro-brain natriuretic peptide is suppressed by O-glycosylation in the region close to the cleavage site. ... RESULTS: Part of the proBNP molecule (amino acid residues 61-76) located near the cleavage site was inaccessible to specific MAbs because of the presence of O-glycans, whereas the same region in NT-proBNP was completely accessible. ... CONCLUSIONS: Only proBNP that was not glycosylated in the region of the cleavage site could effectively be processed into BNP and NT-proBNP. ...

Еще в разделе: (Показать все результаты (>57) - biochem.bio.msu.ru/ )

• The role of intrinsically disordered regions in the structure and functioning
• Development of a candidate secondary reference procedure (immunoassay based

... 13, Moscow, 119992 Russia 2 Special Astrophysical Observatory, Russian Academy of Sciences, Nizhnii Arkhyz, Karachai-Cherkessian Republic, 369167 Russia Received May 18, 2009 Abstract--Using the method of two-dimensional spectroscopy, we have investigated the kinematics and distribution of the gas and stars at the center of the early-type spiral galaxy NGC 7177 with a mediumscale bar as well as the change in the mean age of the stellar population along the radius. ...

Еще в разделе: (Показать все результаты (>51) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/al292.pdf
• http://sn.sai.msu.ru/~sil/preprints/bul_eng.pdf
• http://sn.sai.msu.ru/~sil/preprints/al227.pdf

... All the submitted manuscripts undergo a standard single-blind peer review process. This process is divided into the following stages. ... As a result of the first stage, the submitted manuscript may be returned to the authors for the needed corrections or be declined, or be accepted for peer review. ... The reviewers follow the Publication Ethics and evaluate the submitted manuscript objectively. ... A new revised manuscript submitted by the authors undergoes the above peer review process. ...

Еще в разделе: (Показать все результаты (>352) - num-meth.srcc.msu.ru/ )

• A probabilistic relation between the error estimates of physical quantities
• "Correction of solar dopplergrams' large-scale flatfield"
• "Galactic dynamo equations with random coefficients"

... Salmonella typhimurium LT2, section... 147 9e-36 >AE008909 AE006468 |AE008909| ... Sbjct: 9915 aaacataaagtgatcgccagctgctttttcgaagcctc 9878 Database : fg Posted date: Dec 18, 2007 6:08 PM Number of letters in database : 12, 243 ,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 21,910 Number of extensions: 1351 ...

Еще в разделе: (Показать все результаты (>16920) - kodomo.fbb.msu.ru/ )

• allpy: 0411fa851bba test/usecase2.py
• allpy: log
• allpy: 24a058450d72 test/usecase2.py

The opinion of the members of the Russian Rectors ' Union delegation of the results of the Fourth All- Russian Students ' Forum The Vice-president of the Russian Rectors ' Union, Chairman of the Council of Rectors of higher educational institutions of the Siberian Federal District and the Novosibirsk region, Rector of Novosibirsk State Technical University N.V. PUSTOVOY: The participation of the Russian ...

Еще в разделе: (Показать все результаты (>41) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/327.doc
• http://www.rsr-online.ru/doc/!2013/09/01/1.pdf
• http://www.rsr-online.ru/doc/norm/94.doc

Moscow State University Geological Faculty, Department of Geophysics . ... The signs of distortions on VES data and their role for data interpretation . ... TES field technology . ... Data processing and interpretation . ... Data visualization for TES technology. ... Field example. ... In MSU this technology appeared in 1991. ... TES modification consists of the four interconnected technologies: field measurements, data processing, visualization and interpretation. ... E-mail: sh@geophys.geol.msu.ru . ...

Еще в разделе: (Показать все результаты (>69) - geophys.geol.msu.ru/ )

• TES. Processing
• Page 2
• TES. Conclusion

... 2012 1 CAD-4 Stadivari : RUN, FRAME, a X-Area (1) (2) .hkl. ... X-Area), . ... Ia a X-Area , , X-Area/ X-Area (I) (II); (I)- ( X-Area) File Edit Instrument Display Peak/Cell Integrate Extras Help (2)- , (1)­ Instrument/ Measure/Mo (2) -File Runlist Extras Help X-Area , (I), (II) ( EXTRAS ). , . ... 1) Peak/cell, Recipe/Index/Refine, Index, Direction, Cell, Refine - Exit 6)- (max , , , ) Run Optimizer. ... 1) Peak/cell, Recipe/Index/Refine, Index, Direction, Cell, Refine ­ Exit Cell, Refine 11)- ( )....

Еще в разделе: (Показать все результаты (>720) - chem.msu.ru/ )

• Gas-transport processes in industrial float glasses
• Moscow University Chemistry Bulletin Vol. 53, No. 4, P. 219 (2012)
• New metallocenes of early transition metals with functional groups in organic

... Research objects and scientific purposes . Space scientific program includes development and launch of two supersmall spacecrafts "Universitetskiy" and "Kompas-2" intended for monitoring of radiation conditions near the Earth. ... All the studies conducted in the near-Earth space are characterised by strong radiation fields. ... The circular polar orbits, which cover all the near-Earth space, are the most favorable for comprehensive studies of the radiation conditions near the Earth. ...

Еще в разделе: (Показать все результаты (>72) - cosmos.msu.ru/ )

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Short Reference Image Quality Estimation Using Modified Angular Edge Coherence . Publication type . Conference paper . ... Publication date . September 2010 . Conference . 20-th International Conference on Computer Graphics GraphiCon'2010 . ... BookTitle = {20-th International Conference on Computer Graphics GraphiCon'2010}, . ... Year = {2010}, . ...

Еще в разделе: (Показать все результаты (>853) - imaging.cmc.msu.ru/ )

• Laboratory of Mathematical Methods of Image Processing
• Ringing effect modeling | Laboratory of Mathematical Methods of Image...

SAO is Russia's main centre for ground-based space research. ... The basic instruments of the Observatory are the optical telescope BTA (Big Alt-azimuth Telescope) with a main mirror diameter of 6 m and the radio telescope RATAN-600 with the antenna diameter 600 m. Study of the Universe as a whole, analysis of non-stationary energy release in galactic and extragalactic objects of various types, investigation of evolution and chemical composition of our Galaxy and the nature of solar activity. ...

Еще в разделе: (Показать все результаты (>28) - www.issp.ac.ru/ )

• Astronomy and Space Physics: Russian Federation Olympiad 1995/96

... AN INFORMATION SYSTEM FOR TRACKING STUDY SUBJECT'S STATUS IN CASE-CONTROL INVESTIGATIONS IN THE CHERNOBYL REGION L. Lukyanova, S. Kulikov, E. Maslova1, T. Taggart (Moscow, Seattle) The reliability of an epidemiological study's results depends in part upon the quality of data collection procedures and instruments. Online control of project process is an important part of data management, especially in international multicenter studies. ... 1-, 2­, 3­ - 1- (1.1-, 1.2 ), 2- , 3- , 4- - 1. ...

Еще в разделе: (Показать все результаты (>293) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc185251/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc151676/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc37180/eng.pdf

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>2) - apollo.sai.msu.ru/ )

• MASTER-II Kislovodsk

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Burenkov A.N. , Chavushyan V.H. , Ili? ... A. , Kollatschny W. , Burenkov A.N. , Chavushyan V.H. , Bochkarev N.G. , Le?n-Tavares J. в журнале Astronomy and Astrophysics , издательство Springer Verlag (Germany) , том 528, ? ... Boulesteix J. , Sil?chenko O.K. , Zasov A.V. , Burenkov A.N. в сборнике IAU Colloq. ...

Еще в разделе: (Показать все результаты (>3279) - istina.msu.ru/ )

• Astronomical Journal - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Prugniel P. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Smith M. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Calcareous paleosols are widely distributed throughout the arid and semi arid regions of the world. These paleosols have been described from virtually every continent of the world, yet there is no internationally agreed upon nomenclature for the description of the horizons present within them. ... This abstract proposes the adoption of a universally agreed-upon system of horizon designation and gross morphological description of calcareous paleosols. ... Soil Science, 101, 347-360. ...

Еще в разделе: (Показать все результаты (>175) - www.fadr.msu.ru/ )

• Untitled
• Abstracts
• Root Traces and the Identification of Paleosols

Infrastructure for statistical education . Since 2003 the UIS RUSSIA team concentrates at statistical domain aiming to implement an infrastructure for statistical education and evidence-based applied analysis and full scale social and economic investigations. The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>128) - srcc.msu.ru/ )

• D.Moss, R.Stepanov, T.G.Arshakian, R. Beck, M.Krause, D.Sokoloff, Multiscale
• Arshakian T. G., Stepanov R., Beck R., Krause M., Sokoloff D. Simulations of
• Beck R., Frick P., Stepanov R., Sokoloff D. Recognizing magnetic structures by

... HELP ON SCREENING OF PATTERN OR ALIGNMENT AGAINST PROTEIN PROTEIN . ... The method of looking for all pattern entries (possibly inexact) in PROTEIN databank is almost the same as in PROSITE screening procedure. ... The screening by query alignment, based on the same principle: the alignment is seen as a pattern defining letter's frequencies in every position. The pattern example: . ... the only one capital letter at a position means that only given residue should be at the position. ...

Еще в разделе: (Показать все результаты (>206) - www.genebee.msu.ru/ )

• Multiple alignment
• Screening by similarity
• RNA secondary structure prediction