V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial hypermagnetic helicity evolution, J. Cosmology and Astroparticle Phys., 06, 008, 2012. The hypermagnetic helicity density at the electroweak phase transition (EWPT) exceeds many orders of magnitude the galactic magnetic helicity density. ... This should be taken into account in scenarios of galactic magnetic field evolution with a cosmological seed. ...

Еще в разделе: (Показать все результаты (>64) - srcc.msu.ru/ )

• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial
• Leading scientific fellow Sergey Piskarev Ph.D.
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>48) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>4) - www.issp.ac.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>101) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>154) - www.philol.msu.ru/ )

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>64) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4

... РЕФЕРАТЫ СТАТЕЙ ПО РУКОКРЫЛЫМ / ABSTRACTS OF BAT ARTICLES . Глобальная оценка полноты ископаемых остатков рукокрылых / Global completeness of the bat fossil record: - Eiting, T.P., Gunnell, G.F., Journal of Mammalian Evolution, 16(3): 151-173, 2009. ... Measures of completeness of the fossil record have important consequences for our understanding of evolutionary rates and patterns among bats. ... At the genus level, the bat fossil record is estimated to be 12% complete. ...

Еще в разделе: (Показать все результаты (>711) - zmmu.msu.ru/ )

• Order Chiroptera
• Bat specialists
• Russian Journal of Theriology

... Line: 1 to 1 . Welcome to TWiki, a web-based collaboration tool, document management tool, and knowledge base tool. ... Changed: . Complete documentation for Webmasters, system administrators, anyone interested in installing and fine-tuning a TWiki site. ... TWikiVariables . ... A collection of single-page topics: clear, concise how-to guides designed for busy TWiki users. ... TWikiVariables : Manipulate text, graphics, calculations, and more with simple expanding text strings. ...

Еще в разделе: (Показать все результаты (>31963) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (13 vs. 14) - TWiki
• %TOPICTITLE% (12 vs. 13) - TWiki
• %TOPICTITLE% (18 vs. 19) - TWiki

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>101) - herba.msu.ru/ )

• Publications about flora
• Complete flora of islands and lakes as a statistical hypothesis

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>98) - higeom.math.msu.su/ )

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>35) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>3) - bioinf.fbb.msu.ru/ )

. Источники: . 226 Ra . Неизвестные . 1 . 2 . 3 . 4 . Масшаб по Y: . 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 . Время измерения . 1 2 3 4 5 6 7 8 9 10 50 100 сек . alt=" Your browser understands the APPLET> tag but isn't running the applet, for some reason." Your browser is completely ignoring the APPLET> tag!

Еще в разделе: (Показать все результаты (>121) - nuclphys.sinp.msu.ru/ )

• Определение расстояния между источником и детектором
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение толщины пластин

Academic English Part 4 of 4 Sources: 1. ... Cambridge University Press Unit After · · 51 completing the tasks the students will: Learn about US system for higher education in science Learn some communicative strategies they might use when asking for help or information from colleagues · Learn to write a CV and participate in an interview · Revise their reading strategies · Revise their summarizing strategies Camb 1. 2. 3. 4. ridge English for Scientists, Unit 1, pp.6-7 all ...

Еще в разделе: (Показать все результаты (>17) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>6) - lhe.sinp.msu.ru/ )

Each Apache module is described using a common format that looks like this: . Status: status . ... This indicates how tightly bound into the Apache Web server the module is; in other words, you may need to recompile the server in order to gain access to the module and its functionality. ... A module with "Extension" status is not normally compiled and loaded into the server. ... Modules which are not included with the base Apache distribution ("third-party modules") may use the "External" status. ...

Еще в разделе: (Показать все результаты (>45) - neptun.sai.msu.ru/ )

• Apache modules
• Apache module mod_dir
• Definitions of terms used to describe Apache directives

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>4) - mouse.belozersky.msu.ru/ )

• wLake algorithm description

Geology at Moscow State University . ... Our adjunct Professors . ... The faculty permanently extends the contacts with many overseas universities. The graduator of 1991 Artem R. Oganov who completed his PhD degree in University of London and now works as a leader of the group in ETH (Zurich) was recently nominated by the Faculty Scientific Council as an adjunct Professor. Prof. Dr. Artem R. Oganov . ... 2) Adjunct Professor, Geology Department, Moscow State University, Moscow 119899, Russia. ...

Еще в разделе: (Показать все результаты (>46) - www.geol.msu.ru/ )