Starting PROFILES you just click on the "FILE-LOAD" button. By "BROWSE" buttons you choose the profiles you want to use. Note : Times when the profiles were taken must be contained in the end of the file name (e.g. "p082023.fts", "prof082023.fts", "082023.fts") and the files must be fts files obtained for example in XLOOK. You are supposed to choose the profiles in the right order according to the time. ... RANGE" button: ranges of axes . TITLE" button: titles of axes . ...

Еще в разделе: (Показать все результаты (>131) - lnfm1.sai.msu.ru/ )

• Manpage of FITSHDR
• Calibration data
• FITShdr: INSTALL

... Полная версия этой страницы: Каррент мьюзик . Студенческий форум Физфака МГУ > Общий > ТРЕП > Карренты . ... True andЪ EvilЪ . ... Posted by 195.91.219.66. of WebWarper: see /han Example of using WebWarper: http://www.webwarper.net/ww/~av/forum.dubi...hp?showforum=42 ] . ... Posted by 195.91.219.66. of WebWarper: see /han Example of using WebWarper: http://www.webwarper.net/ww/~av/forum.dubi...dex.php?act=idx ] . ... 8.12.2005, 0:27 . ...

Еще в разделе: (Показать все результаты (>494) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Ассоциации
• Студенческий форум Физфака МГУ > Current Doing
• Студенческий форум Физфака МГУ > Игра "кошка или собака"

... создается некое подобие 3-х мерного пространства Слова показа и и отображены таким же способом. -- param name =example_object_0 value = pltext step =20 font =Verdana:28,3 value =%АППЛЕТ% link = exline :0 color =#009999 param name =example_object_1 value = pltext step =20 shifts=2,2 font =Verdana:28,3 value =%АППЛЕТ% link = ...

Еще в разделе: (Показать все результаты (>15) - adept.srcc.msu.ru/ )

• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer4text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/cursor/cursor1text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer1text1.htm

... Mathematical Treatment of Exhaust Systems with Acoustic Properties Using Mathlie I. Algorithms . ... The first part of the two talks is concerned with   algorithms applied to examples origin from an   exhaust system. ... The model equations are determined   by conservation of mass, momentum and energy. In addition there exists an equation of state   for the ideal gas system. ... Applying computer algebra to   these model equations, we demonstrate that   solutions can be derived. ...

Еще в разделе: (Показать все результаты (>87) - acs366.phys.msu.su/ )

e-mail: viverhovin@yandex.ru) , , , corruption, the western enforcement system, corruption scandals, statistics of corruption in the western countries . ... Analysis and criticism of some apologetics examples of the western market society, not capable to minimize corruption at different levels of its organization is given. Necessary statistical and actual arguments in favor of the author's viewpoint are resulted. ...

Еще в разделе: (Показать все результаты (>22) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2012/3/07.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/3/13.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/4/09.pdf

LangueDOC . ... Languages . ... Archi . ... The phonetic system of Archi is very rich, and the writing systems that are familiar to Archi speakers (Russian cyrillic and Avar cyrillic) are not sufficient for recording all sounds of the language. ... Kibrik et al. 1977] ? the notation used in this dictionary is given in the comparative table below under the label "1977"; [Kibrik, Kodzasov 1990]), but they were too difficult for the Archi speakers to learn and therefore remained inaccessible to them. ...

Еще в разделе: (Показать все результаты (>221) - www.philol.msu.ru/ )

• Title: Russian Language Training via INTERNET. Internet-based educational

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>110) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• AliComp - GeneBee Alignments Comparison - Advanced
• GeneBee service

... Software . Laboratory of Mathematical Methods of Image Processing . ... Available options: -sigma - (mandatory) set blur parameter for the input image , range: 1.0 to 20.0 - power - set warping power , range: 0.0 to 5.0, default value is 1.0 -1d - apply one-dimensional algorithm (faster but lower quality) basicedges - detect basic edges - edges good for artifact analysis -scale - set scale parameter, range: 1.0 to 20.0, default value is 4.0 gaussblur - blur input ... warp.png . ...

Еще в разделе: (Показать все результаты (>103) - imaging.cmc.msu.ru/ )

Thursday, June 24th, 2010 . ... Wednesday, June 16th, 2010 . На сайт добавлен пакет Lightbox 2.04 (http://www NULL .huddletogether NULL .com/projects/lightbox2/) (by Lokesh Dhakar) для отображения графики с дополнительными визуальными эффектами: . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for June, 2010. ... Наши публикации . ... Публикации за 2011 . Публикации за 2012 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>4) - geo.sai.msu.ru/ )

• Lightbox 2 Лаборатория лазерной интерферометрии
• site lightbox Лаборатория лазерной интерферометрии
• Uncategorized Лаборатория лазерной интерферометрии

extra:main ]] . CompHEP . ... Script for including cuts, kinematics, or regularizations into batch.dat file . Script for CompHep cross-sections energy dependence calculation . ... When you done CompHep calculations for the process under study at one energy, you may easely get cross-sections energy dependence running script cs_energy_dep.pl . ... For every energy point the script modifies results/batch.dat file and runs CompHep script num_batch.pl to calculate given process cross-sections. ...

Еще в разделе: (Показать все результаты (>9) - comphep.sinp.msu.ru/ )

• tutorials [CompHEP]

ChangeLog for snakes # # Generated by Trac 0.12.5 # 04/11/16 22:55:00 Mon, 20 Dec 2010 14:01:39 GMT Daniil Alexeyevsky me.dendik@тАж [134:8e75e931bfd2] * snakes / example.snake ( modified ) example.snake : better rules for chasing enemy tail Mon, 20 Dec 2010 11:57:44 GMT Daniil Alexeyevsky me.dendik@тАж [121:06e4b4ea7596] * snakes / example.snake ( modified ) * ...

Еще в разделе: (Показать все результаты (>383) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=360c297c05f3577ca730ecaf86131163456f6b73&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=138%3A416418c9aaef&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=416418c9aaefbd75f3451a63f12d0ab8af3b89f3&limit=100&mode=stop_on_copy

... Alechin , Vasilii Vasilievich (1884-1946) . Alexeev , Eugeni Borisovich . Bobrov , Andrej Evgenievich . ... Ehrhart , Friedrich (1742-1795) . Goldbach , Carl Ludwig (1793-1824) . ... Juzepczuk , Sergei Vasilievich (1893-1959) . Karavaev , Mikhail Nikolaevich ( 1903-1992 ) . Khokhrjakov , Andrej Pavlovich (1933-1998) . Kuvaev , Vladimir Borisovich . ... Linnaeus , Carl, fil. ... Sokoloff , Dmitry Dmitrievich . ... Tzvelev , Nikolai Nikolaevich . ... Phone/fax: 7 (095) 939-2777 . ...

Еще в разделе: (Показать все результаты (>139) - herba.msu.ru/ )

• INTERNATIONAL SYMPOSIUM
• Alders in the European Russia
• The employment of quantitative methods for the lake ecosystem research

. Moscow State University . INTERNATIONAL CONFERENCE . H YDRODYNAMIC I NSTABILITY AND T URBULENCE . February 24 ? March 02 , 2008 . Moscow, Russia . Call For Papers Информационное письмо . Author instructions . Abstract example Paper example . Location (More information) . Conference Program Posters . E-mail : gertsens@imec.msu.ru . Institute of Mechanics, Lomonosov Moscow State University . Aerodynamical Installations . Moscow Sights & Attractions

Еще в разделе: (Показать все результаты (>13) - hit-conf.imec.msu.ru/ )

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>93) - www.intsys.msu.ru/ )

• Intelligent Systems :: Teaching :: Seminars :: Список специальных семинаров
• Интеллектуальные системы :: Сотрудники :: Гасанов Эльяр Эльдарович :: Instantly

Название статьи И.О. Фамилия11,a, И.О. Фамилия22,b 1 Название института и полный адрес, например: Московский государственный университет имени М.В.Ломоносова, физический факультет, кафедра общей физики. ... Title in English I.O. Pervyiavtor1,a , I.O. Vtoroiavtor2,b 1 Название института и адрес на английском языке, например: Department of [.. ... Moscow 119991, Russia. 2 Название института и адрес на английском языке, например Sternberg State Institute of Astronomy, Moscow State University. ...

56. XAFS Publication Database search form

57. Atlas

58. HUMAN RIGHTS AND DEVELOPMENT

59. Fortran DVM language description

60. Все о геологии :: ChemEl 1.0