Alignmentfree telomere length estimation from whole genome NGS data Szymon M. Kielbasa1Jelle Goeman2Hein Putter1 NL Consortium orret Boomsma3 , , Go , , D , Eline Slagboom1Kai Ye4 , 1 Department of Medical Statistics and Bioinformatics, Leiden University Medical Center, Leiden, Department for Health Evidence, Radboud university medical center, Nijmegen, The Netherlands Netherlands Twin Register, Department of Biological Psychology, VU ...

Еще в разделе: (Показать все результаты (>38) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/31.pdf

. Home . News . Proceedings . (pub.data ) . Programme (+slides) . Tutorials (+slides) . Participants . Abstracts . Book of Abstracts (PS file) . Photo Gallery . Committees . Topics . HP Grants . Workshop Poster . Inf.Bull. 1 . Inf.Bull. 2 . Inf.Bull. 3 For contacts: . acat02@sinp.msu.ru . Workshop series . ACAT (formerly AIHENP) . Previous Workshop: ACAT2000 .

Еще в разделе: (Показать все результаты (>22) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/tut4.html
• http://acat02.sinp.msu.ru/tutor.html
• http://acat02.sinp.msu.ru/25june.html

. Biometrical Journal (DEU) . Biometrics (USA)

Еще в разделе: (Показать все результаты (>823) - www.sevin.ru/ )

• Фундаментальная экология: Базы данных
• Экологический Форум - Фундаментальная Экология: prada 財布

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

grdinfo - Get information about the contents of a 2-D grd file grdinfo grdfiles [ -C ] [ -L1 ] [ -L2 ] [ -M ] grdinfo reads a 2-D binary grd file and reports various statistics for the (x,y,z) data in the grdfile. ... L1 Report median and L1 scale of z (L1 scale = 1.4826 * Median Absolute Deviation (MAD)). ... To obtain all the information about the data set in file hawaii_topo.grd, try grdinfo -L1 -L2 -M hawaii_topo.grd gmt , grd2cpt , grd2xyz , grdedit . Man(1) output converted with man2html ...

Еще в разделе: (Показать все результаты (>319) - xray.sai.msu.ru/ )

• Binary NS Merging Rate Estimates
• Gravitational Waves from Coalescing Compact Binary Stars
• The Model

... Resources . ... info@ecfs.msu.ru . All contacts . ... Eurasian Center . for Food Security . ... Comments: 0 . 15 october 2015 . ... Agriculture and the rural sector in general, is a major determinant of livelihoods in Europe and Central Asia (ECA). ... In Central Asia/Caucasus, most of the poor are in rural areas, where agriculture employs half of the population. ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ... Contacts . ...

Еще в разделе: (Показать все результаты (>60) - ecfs.msu.ru/ )

• Login | ECFS
• Dosov Botir | ECFS
• Parikh Alka | ECFS

... GeneBee . ... Courses in Bioinformatics . ... What is GCG? ... Usage of GCG Package on GeneBee Server . ... What is WhatIf? ... Computer Class . ... Due to colaborate work of many laboratories the total length of published nucleotide sequences is now . ... GCG vs. ... Usage of GCG Package on GeneBee server . ... Computer class . ... Computer class is used for bioinformatic courses and for scientific semenars. ... Everyone who need a consultation for GeneBee service, GCG or WhatIf package is welcomed...

Еще в разделе: (Показать все результаты (>64) - www.genebee.msu.ru/ )

• Genebee Predicted Annotation
• Genebee Predicted Annotation - Advanced
• GeneBee BLAST 2.2.22+ Services Help

... Наши профессиональные области: прикладная статистика, анализ сигналов и контроль процессов биологической и физической природы, история, философия, религия и др. ... Прочие же антропометрические показатели автора крайне заурядны и не представляют абсолютно никакого исследовательского интереса. см. также: Внатуре Арийская генеалогия Мастера . ... CONAN-t - Integrated Computer Series for Frequency Analysis, Control and Automation over Processes in Industrial and Technical Applications . ... Download . ...

Еще в разделе: (Показать все результаты (>15) - www.protein.bio.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>33) - brain.bio.msu.ru/ )

... Форумы > Аспирантура > Тема . Автор темы Alexey Chernov . Форумы Список тем Новая тема . ... Аспирантская вакансия: байесовский анализ в геномике . ... PhD Student Position in Statistics: "Bayesian Methods for Integrated Genomics" (Switzerland) . ... Strong candidates will have the chance to work on this in later stages of their PhD. ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>878) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | предложение о работе
• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida
• Первый Чемпионат Moscow CS Tour по Counter Strike прошел в Cafemax в МГУ

... Instrument panel contains (from left to right): sample fast approach/retract buttons, stepper power supply on/off button (if this feature is enabled in program configuration), show statistics button, sound on/off button, volume control buttons, toggle to small window button (in the small window regime only instrument panel and oscilloscope is shown, window title is reduced, window is always on top of other windows), button that opens About window. ...

Еще в разделе: (Показать все результаты (>15) - www.spm.genebee.msu.ru/ )

... Геология >> Информационные технологии | ... Программа ищет и показывает закономерности в организации линейных элементов дистанционных данных. ... С не меньшим основанием можно анализировать рисунок хребтов и долин в цифровых моделях рельефа (ЦМР). ... И, наконец, LESSA позволяет анализировать бинарные схемы полученные любым другим путем, например, схемы ручного дешифрирования линеаментов, схемы гидросети и т.д. ( подробности на сайте http://www.lineament.ru ) . ...

Еще в разделе: (Показать все результаты (>1137) - geo.web.ru/ )

• COMPASS
• Юрий Визбор - "Она мне ясно говорит..."
• Валентин Вихорев - "У августа, мой друг, прохладный ясный день..."

... Invariants for Generalised Burgers Equations . ... Recently, one of the authors (NHI) adopted the infinitesimal method for calculating invariants of families of differential equations using the equivalence groups. ... Here, we use the above method for calculating invariants of the family of generalised Burgers equations which has applications in acoustic phenomena and furthermore has been used to model turbulence and certain steady state viscous flows. ...

Еще в разделе: (Показать все результаты (>6) - acs366.phys.msu.su/ )

• AUTHOR : Ibragimov N
• AUTHOR : Sophocleous C

... Detailed design . ... 5 Message passing tools, independent from base system of message passing . ... 7 Tracing user program and Run-Time System . ... 7.2.5 Controlling internal self-checking Run-Time System mechanisms, functioning during trace accumulation . 7.2.6 Controlling output of additional information when tracing some Run-Time System functions in extended mode . ... 8 Output of informational messages of Run-Time System and error messages . ... Lib-DVM - detailed design (contents) . ...

Еще в разделе: (Показать все результаты (>81) - sp.cs.msu.ru/ )

• Lib-DVM library. Detailed design. Part 2
• Debugging DVM-program performance. User's guide

. WWW Statistic . Postgraduate student of 1 year of Institute of Astronomy of Russian Academy os Sciences . Young reseacher of Astronomical Division . ( Sternberg Astronomical Institute ) . Faculty of Physics . Moscow State University . Observer of student's astronomical observatory . Programmer of the NEXT Company .

Еще в разделе: (Показать все результаты (>50) - comet.sai.msu.ru/ )

• Courses
• What is the history of this file?
• WWW and Web Tools

News . News Archive . ... SUNY @ Albany Delegation from the Department of Mathematics and Statistics headed by the Dean E. Turner including prof. B. Goldfarb and prof. K. Zhu. ... Do not leave without exploring our News Archive . ... suny-msu . ...

Еще в разделе: (Показать все результаты (>5) - suny.msu.ru/ )

LABORATORY . ... It was founded by two young Candidates of Philology who had just got their scientific degrees Boris Andreevich Uspensky and Vladislav Mitrofanovich Andruschenko as interdepartmental laboratory based on three departments: the English Language Department of the Philological Faculty, Foreign Languages Department for the Humanities and Arabic Department of the Institute for Asia and Africa. ... Vladislav Mitrofanovich Andruschenko was at the Head of the Laboratory from 1964 till 1983. ...

Еще в разделе: (Показать все результаты (>2) - lcl.srcc.msu.ru/ )

... K. Krylov . There was undertaken a research of lengthes of marinon - some integral units obtained by segmenting of comleted (whole) fiction prosaic texts (stories, small novels, novels). ... Overall corpus of considereded texts (Russian fiction prosaic) contain more than two million of graphic running words. Undertaken research has lead us to revealing of three main regularities. 1) to formulation of the law of optimum relation between number of elements within each submicroscopic level; . ...

Еще в разделе: (Показать все результаты (>70) - old.philol.msu.ru/ )

• MSU - Laboratory for General and Computational Lexicology and Lexicography

Russian . ... E-Mail: admin@fadr.msu.ru . Web-development . ... Advertising . ... We offer you the unique possibility to set your advertising information on the oldest (opened at 1994) and most popular Russian agrarian server. ... Price list for advertising at FADR sites* . 1.Banner ** . ... Warranty top positioned banner: +30% of total price . Banners requirements. ... Banner size cannot exeed 20 kb. ... Our price for banners development is very low. ... Price for banners development* . ...

Еще в разделе: (Показать все результаты (>109) - www.fadr.msu.ru/ )

• Abstracts
• Total web report on fadr.msu.ru - October 2004

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...