... Allowing User Functions at Process Termination . ... There are times in which it would be convenient to have actions happen when an MPI process finishes. For example, a routine may do initializations that are useful until the MPI job (or that part of the job that being terminated in the case of dynamically created processes) is finished. This can be accomplished in MPI-2 by attaching an attribute to MPI_COMM_SELF with a callback function. ... Центры . ...

Еще в разделе: (Показать все результаты (>441) - www.parallel.ru/ )

• An Application Example | PARALLEL.RU - Информационно-аналитический центр по
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по
• Low-level topology functions | PARALLEL.RU - Информационно-аналитический центр

... The Chemical Consequences of Cavitation . ... High intensity ultrasound has found new applications in driving chemical reactions and in the preparation of unusual materials. The chemical effects of ultrasound originate from acoustic cavitation:   the formation, growth, and implosive collapse of bubbles in a liquid. ... In otherwise cold liquids, ultrasound is able to drive reactions that normally occur only under extreme conditions. ...

Еще в разделе: (Показать все результаты (>328) - acs366.phys.msu.su/ )

• Abstract
• AUTHOR : Sudenkov Yu
• AUTHOR : Savitskaya N

New ideologeme, the idea of civil solidarity, humanitarian culture, provoking actions, virtual reality, quality of education . In this article, the problem of sociological knowledge new ideologeme formation in controversial conditions of Russian society transformation and higher education system reformation is discussed. ...

Еще в разделе: (Показать все результаты (>81) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/4/04.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/2/13.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/3/07.pdf

... grep -s keith > /dev/null then echo keith is logged in else echo keith not available fi . This lists who is currently logged on to the sytem and pipes the output through grep to search for the username keith . The -s option causes grep to work silently and any error messages are directed to the file /dev/null instead of the standard output . If the command is succesful i.e. the username keith is found in the list of users currently logged in then the message keith is logged on . ...

Еще в разделе: (Показать все результаты (>510) - comet.sai.msu.ru/ )

• Examples of using the mv command
• Example of using the case statement
• The Structure of HTML 3.0 Documents

... Полная версия этой страницы: Конференция Reaction Kinetics in Condensed Matter 2010 . Студенческий форум Физфака МГУ > Наука физика > Конференции, семинары и другие мероприятия . ... 5.8.2010, 15:00 . Конференция проводится 22-26 сентября 2010 на базе МГОУ. ... Reaction Kinetics in Condensed Matter 2010 (RKCM'10) is the first of the new series of international conference in the field of kinetics of chemical reactions in condensed matter. ...

Еще в разделе: (Показать все результаты (>637) - wasp.phys.msu.ru/ )

• Конференция Reaction Kinetics in Condensed Matter 2010 - Студенческий форум
• Студенческий форум Физфака МГУ > C++

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>21) - mouse.belozersky.msu.ru/ )

• wLake program homepage
• Example of alignment

Microsymposium 38, MS015, 2003 (letter format) MARS: MOVEMENT OF GEOGRAPHICAL POLES AND DEFORMATION OF ITS SURFACE. ... The global analysis of the Earth linear structure elements has allowed to define the position of geographical poles in the different geochronological periods [3, 4]. ... It is the curves that unite sequences of geographical poles - poles of symmetry of faults in the global stress field fixed by faults on a surface of the mantle during its rotation around of the core. ...

Еще в разделе: (Показать все результаты (>99) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Chik/Publications/ms42/m42_12.pdf
• http://selena.sai.msu.ru/Rod/Publications/ms40/21_Dolitsky_etal.pdf
• http://selena.sai.msu.ru/Ber/Publications/ms40/88_Yamashita%20et_al.pdf

Three-waves interactions of surface defect-deformational waves and their role in selforganization of micro- and nanostructures under laser action on solids Diploma thesis abstract Selforganization of nano and microstrutures of the surface relief under the action of external energy (laser and ion) beams is considered as an instability of quasistatic surface defectdeformational (DD) waves formed by coupled quasistatic Lamb and Rayleigh acoustic waves and defect concentration waves. ...

Еще в разделе: (Показать все результаты (>191) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2014/Mamaeva_Saveliev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Smirnova_Shkurinov_en.pdf
• Laboratory of solid-state lasers and coherent spectroscopy

. A program for alignment of structures of DNA-protein complexes . Home . Feedback . Help . About . Input PDB code of the first complex: and chain of the protein (optional): . Input PDB code of the second complex: and chain of the protein (optional): . If you get stuck with program input, try example data and click Align! Example data . 2016

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• ConClus

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>229) - www.genebee.msu.ru/ )

• GeneBee service
• Screening pattern or alignmemt against PROTEIN databank
• IGLA-3D User Guide

... Algorithm & . Format requirements . Contact us . Gallery of examples . SDPsite was applied to 124 families fron the Pfam database . ...

Еще в разделе: (Показать все результаты (>141) - bioinf.fbb.msu.ru/ )

• SDPsite - Algorithm Format requirements
• SDPsite
• SDPsite - PF01139

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>9) - biophys.msu.ru/ )

• One of the informative characteristics of the reverse electron transport in the

... 7­8, 2000 UDC 620.18:65.012.12.001/002 REPRODUCIBILITY OF THE STRUCTURE AND PROPERTIES OF PARTS AND THEIR DESCRIPTION WITHIN THE FRAMEWORK OF NONLINEAR DYNAMICS A. Yu. ... The problem of the reproducibility of complex structures is discussed from the standpoint of the applied theory of dynamic systems. ... The problem of the reproducibility of complex structures that appear in nonlinear media has become closely connected with some problems of the applied theory of dynamic systems. ...

Еще в разделе: (Показать все результаты (>74) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/BPHS631.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/JETL524.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/Stabilization_by_point_exitations.pdf

... Compositions of co-existing minerals from graphite bearing carbonatites were obtained by the EPMA analysis for beforsites from Chernigovsky complex (Ukraine)( K rivdik et al., ... 2007) , Chagaday carbonatites, Uzbekistan, Khibina alkaline igneous complex, which includes carbonatites and graphite-bearing rocks (Kola Peninsula) ( N ivin et al., 2005), and carbonatites of Gremyakha-Vyrmes magmatic complex (Kola Peninsula). In all cases graphite-bearing rocks contain magnetite. ...

Еще в разделе: (Показать все результаты (>1065) - geo.web.ru/ )

• Все о геологии :: ChemEl 1.0
• Новое учебное пособие по тектонофизике: ВВЕДЕНИЕ В ТЕКТОНОФИЗИКУ, Авторы: М. А.
• Авторский сайт Владимира Мальцева - литература

... Medium (solvent) coordinates 3. Quantum effect of solvent on activation barrier 4. ... sucrose solutions: C D ( w) = + + 1 + (iw C ) 1 + iw water-EG mixtures: D 3 1 2 ( ) = + + + 1 + i 2 1 1 + i 2 2 1 + i 2 3 series N solvent modes Solvent reorganization energy (exact expansion ) correlation times K ( ) = 2k BT Solvent correlation function i =1 N i exp (- / ) * i i =1 N i = 1 i is the contribution of i-th mode to the solvent reorganization energy The solvent reorganization ...

Еще в разделе: (Показать все результаты (>22) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/probst.pdf
• Molecular aspects of solid state and interfacial electrochemistry
• Laboratory of Electrical Double Layer and Electrode Kinetics

... Gamma-activation analysis is being used to study these processes at SINP MSU. A software package for processing experimental data from HPGe detector has been developed. The program uses Monte-Carlo method to simulate main stages of the experiment and presents results on a graphical interface. (,n) , . ... 5-6 70 . ... HPGe). ... GEANT4 . GEANT4 HPGe , . ...

Еще в разделе: (Показать все результаты (>188) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/nseminar/urin.pdf
• http://nuclphys.sinp.msu.ru/thpu/thpu0.pdf
• Оптическая модель

Theoretical problems of electrical double layer structure on ideally polarizable electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistep electrochemical processes limited by mass transfer, electron transfer and chemical reaction. Special attention is paid to computer simulation of specific adsorption and coadsorption of ions and neutral organic molecules on the electrode surfaces. ...

Еще в разделе: (Показать все результаты (>104) - electr003.chem.msu.ru/ )

• Elena V. Stenina:CV
• Boris I. Podlovchenko: Selected Publications
• Liana N. Sviridova:CV

... Experimental and theoretical study of structure and evolution of hadrons under extreme conditions at high energies . ... Physics of the solar wind, interplanetary magnetic field and solar-terrestrial relations . ... Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . ... Research of fractal structure of aluminosilicates gels by a method of small angle scattering of neutrons and synchrotrons radiations . ...

Еще в разделе: (Показать все результаты (>30) - foroff.phys.msu.ru/ )

• Postdoctoral training (Neutronography)
• Key research directions

Interaction of Modified Humic Substances with Np(V): Influence of Monomer Nature on Redox Properties of Humic Substances Natalia S. Shcherbina, Irina V. Perminova, Anna Bolkova, Anton N. Kovalenko, Stepan N. Kalmykov, V.S. Petrosyan Department of Chemistry, Lomonosov Moscow State University, Leninskie Gory 1/3, Moscow 119991, Russia, comasis@gmail.com Keywords: neptunium, humic, hydroquinone, modification, reduction, kinetics 1. ... This provides for their redox and complexation properties. ...

Еще в разделе: (Показать все результаты (>160) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-philippova-mitigating.pdf
• http://www.mgumus.chem.msu.ru/publication/2005/ksenofontova-ozone-05.pdf
• MGUMUS -- Current projects