... 000todo . 2016-04-08 00:55 . ... 1.0K . ... Apache/2.4.10 (Debian) Server at 127.0.0.1 Port 88 ...

Еще в разделе: (Показать все результаты (>46) - herba.msu.ru/ )

. Home . News . Proceedings . (pub.data ) . Programme (+slides) . Tutorials (+slides) . Participants . Abstracts . Book of Abstracts (PS file) . Photo Gallery . Committees . Topics . HP Grants . Workshop Poster . Inf.Bull. 1 . Inf.Bull. 2 . Inf.Bull. 3 For contacts: . acat02@sinp.msu.ru . Workshop series . ACAT (formerly AIHENP) . Previous Workshop: ACAT2000 .

Еще в разделе: (Показать все результаты (>29) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/tut4.html
• http://acat02.sinp.msu.ru/tutor.html
• http://acat02.sinp.msu.ru/25june.html

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>59) - ecfs.msu.ru/ )

• Resources | ECFS
• Login | ECFS
• Dosov Botir | ECFS

Open Conference Systems . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... January February March April May June July August September October November December 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 . ... By default only papers containing all terms in the query are returned (i.e., AND is implied) . Combine multiple words with OR to find papers containing either term; e.g., education OR research . ...

Еще в разделе: (Показать все результаты (>7) - hea.phys.msu.su/ )

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... The documentation in Russian. ... These systems contain millions lines of code, thousands - tens of thousands classes. Visualization could help programmer to better comprehend these large systems, to orientate between lot of objects of these systems, to analyze intricate structure of code and find required information. ... Doc3D: Система трехмерной визуализации архитектуры программных систем . ...

Еще в разделе: (Показать все результаты (>42) - graphics.cs.msu.ru/ )

• DOC3d: A 3d Documentations system for programming languages | Лаборатория
• x264 codec improvement | Graphics and Media Lab
• x264 codec improvement | Лаборатория компьютерной графики и мультимедиа

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>22) - brain.bio.msu.ru/ )

... K. Krylov . There was undertaken a research of lengthes of marinon - some integral units obtained by segmenting of comleted (whole) fiction prosaic texts (stories, small novels, novels). ... Overall corpus of considereded texts (Russian fiction prosaic) contain more than two million of graphic running words. Undertaken research has lead us to revealing of three main regularities. 1) to formulation of the law of optimum relation between number of elements within each submicroscopic level; . ...

Еще в разделе: (Показать все результаты (>36) - old.philol.msu.ru/ )

• MSU - Laboratory for General and Computational Lexicology and Lexicography
• Using Literal and Grammatical Statistics\\ for Authorship Attribution
• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics

LABORATORY . ... It was founded by two young Candidates of Philology who had just got their scientific degrees Boris Andreevich Uspensky and Vladislav Mitrofanovich Andruschenko as interdepartmental laboratory based on three departments: the English Language Department of the Philological Faculty, Foreign Languages Department for the Humanities and Arabic Department of the Institute for Asia and Africa. ... Vladislav Mitrofanovich Andruschenko was at the Head of the Laboratory from 1964 till 1983. ...

Еще в разделе: (Показать все результаты (>17) - lcl.srcc.msu.ru/ )

News . News Archive . ... SUNY @ Albany Delegation from the Department of Mathematics and Statistics headed by the Dean E. Turner including prof. B. Goldfarb and prof. K. Zhu. ... Do not leave without exploring our News Archive . ... suny-msu . ...

Еще в разделе: (Показать все результаты (>2) - suny.msu.ru/ )

... Invariants for Generalised Burgers Equations . ... Recently, one of the authors (NHI) adopted the infinitesimal method for calculating invariants of families of differential equations using the equivalence groups. ... Here, we use the above method for calculating invariants of the family of generalised Burgers equations which has applications in acoustic phenomena and furthermore has been used to model turbulence and certain steady state viscous flows. ...

Еще в разделе: (Показать все результаты (>7) - acs366.phys.msu.su/ )

• AUTHOR : Ibragimov N
• AUTHOR : Sophocleous C

... Statistics in Medicine [Stat Med] . Common information . ... no information] . ... 0277-6715 . ... since 1982-01-01 till today . ... subscription - $3270,single article - $32 . ... medicine . ... http://www3.interscience.wiley.com/cg.. ... 1982-01-01 . today . ...

Еще в разделе: (Показать все результаты (>31) - journals.genebee.msu.ru/ )

• JCatalog - Science Magazines Catalog
• JCatalog search page

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

54. LESSA - единое описание аэрокосмических изображений, схем и цифровых моделей

55. Generated Documentation (Untitled)

56. Publications of E.A.Morosova

57. http://www.socio.msu.ru/vestnik/archive/2011/4/10.pdf

58. http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2013/Pastukhov_Vladimirova_en.pdf