University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>58) - cosmos.msu.ru/ )

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Еще в разделе: (Показать все результаты (>18) - imk.msu.ru/ )

• Институт мировой культуры МГУ

... PDF created with pdfFactory trial version www.pdffactory.com 2 . ... 2001. ... 1977. ... 1987. ... 1983, 1987. ... 1985. ...

Еще в разделе: (Показать все результаты (>20) - dynamo.geol.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

ERROR: You need to create the directory /home/www/hist/vledata with web server write access . ... В настоящее время материалы дистанционной поддержки к курсам, читающимся на историческом факультете МГУ им. М.В.Ломоносова, вы можете найти по адресу: vle.hist.msu.ru Skip Calendar . ...

Еще в разделе: (Показать все результаты (>37526) - hist.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>30) - erg.biophys.msu.ru/ )

• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической
• Lipid membrane MD modeling with GROMACS ERG Research Group: Лаборатория
• membrane ERG Research Group: Лаборатория теоретической биофизики

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>33) - ideas.msu.ru/ )

... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Index of publishers and journal titles . You can find some material through alphabetical list, here are publisher's and journal's lists. ... Physico-chemical biology" list contains magazines whitch is used very often by biologists of Belozersky institute, it had been gathered by Vladimir Melgunov. ... All biology Journals . ... JCatalog | ... Belozersky's Institute of Physico-Chemical Biology . ...

Еще в разделе: (Показать все результаты (>182) - journals.genebee.msu.ru/ )

• JCatalog - publishers alphabet index
• JCatalog - Different journal alphabetic indexes
• JCatalog - Science Magazines Catalog

THE REETHERM DATA BANK FOR MODELING OF GEOCHEMICAL PROCESSES WITH PARTICIPATION OF RARE-EARTH ELEMENTS K.G.Morgunov, G.R.Kolonin, G.P.Shironosova Institute of Mineralogy and Petrography SB, RAS, Novosibirsk This study was supported by the Russian Fundamental Research Foundation (Project No. 98-05-65299) and by the program Universities of Russia - fundamental researches (grant 2787) Herald DGGGMS RAS 5 (15)'2000 v.2 URL: http://www.scgis ...

Еще в разделе: (Показать все результаты (>330) - geo.web.ru/ )

• http://geo.web.ru/COMPASS/geo.html
• http://geo.web.ru/users/pavel/Publications/1992_1998/ARTEN976.DOC
• Pletchov Pavel biography info

I. (SCIENCE CITATION INDEX ­SCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Еще в разделе: (Показать все результаты (>23) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>11) - hcs.cmc.msu.ru/ )

... As a perfect bag of Hermes, it isn?t strange to determine it sold at $6,750. ... Didn`t suggest we don?t adore determine producer creative designers, . ... We will try our excellent to dig his worth come up with him merged properly making use of the brand, . ... I stated to plenty of folks that Christophe may be among the many most ideal one, . ... Leather: Handbags created by Hermes uses only animal skin. ... http://www.slcamera.it/every-man-adores-his-car/ . ...

Еще в разделе: (Показать все результаты (>86) - elana.sinp.msu.ru/ )

• is doing an amazing job at gucci. Everyone thought organization was gonna be
• absurdly. | С Днем Победы!
• michael kors outlet uk The following diets will be discussed | С Днем Победы!

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>25) - genphys.phys.msu.su/ )

• To Do List History

... Like ordinary make, metamake keeps platform-dependent files (object, executables, libraries) for repeated usage. To use the metamake, one must define basic project directories (task directory, target root, object directory etc) and prepare two simple files: task-file that contains common project settings (selected compilers, common system libraries etc) and architecture- independent Imake-file which includes project description along with compiler and linker directives. ...

Еще в разделе: (Показать все результаты (>65) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/brun/Solutions_2.doc
• http://acat02.sinp.msu.ru/presentations/kryukov/acat02-020625.pdf
• http://acat02.sinp.msu.ru/presentations/tyupikova/doclad.doc

... Available trees in the HiForest : hiEvtAnalyzer/HiTree - Event property tree. ... Pb-Pb (2.76 TeV): /eos/ cms /store/group/phys_heavyions/icali/MinBias_Merged.root ( https ://twiki.cern.ch/twiki/ bin /viewauth/ CMS /HiForest#Data ) P-Pb (run 202792): /afs/cern.ch/user/t/tuos/work/public/pPb/Data/ PAPhysics-pt01-full_WithCentrality.root ( https ://twiki.cern.ch/twiki/ bin /viewauth/ CMS /PPbCentralityAna , https ://twiki.cern.ch/twiki/ bin /viewauth/ ...

Еще в разделе: (Показать все результаты (>44) - lav01.sinp.msu.ru/ )

• History of Strong Interactions Laboratory

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . Online Services | ... Links | ... Contacts | ... CDFE => Online Services => Nucleus Ground and Isomeric States Parameters Search Engine . The source of data is the Nuclear Wallet Cards database prepared and maintained by the USA NNDC. ... Show nuclear moments/deformations for selected nuclei . ... Metastable states: . ... If you have any questions, comments, and/or suggestions, please, contact . ...

Еще в разделе: (Показать все результаты (>30) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE => Online Services => Relational ENSDF

... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>11) - lhe.sinp.msu.ru/ )

• Brief CompHep Installation Instruction

. People on #C4ACTbE as of 18 Jan 2001 18:45 MSK . Nickname . Status . User@Host . C4ACTbEP . idle . This is me, the channel bot. XAM[c] . idle . u0948@mvs.imm.uran.ru . Igorek . idle . igorek@kronos.psu.ru . Berendeev . - . graffity@ts16-a82.dial.sovam.com . Created by quesedilla v3 via eggdrop This page is automatically refreshed.

Еще в разделе: (Показать все результаты (>4) - asa.guru.ru/ )

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>40) - eng.geogr.msu.ru/ )

• Department of Cartography and Geoinformatics

... INTRODUCTION Rendering of the photorealistic images of three-dimensional scenes remains a significant problem in computer graphics nowadays. ... When rendering, texture is represented by a bitmap image imposed on the surface of the 3Dmodel to give it color or the illusion of relief. ... Figure 2: Vectors in proposed model. ... 4.2 Determining of Model The input to the algorithm receives N images of a plane surface with a metallic and a synthesized image with the glare and texture without metallic. ...

Еще в разделе: (Показать все результаты (>136) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2008.cyprus.yurin.plf.en.pdf
• View publication | Laboratory of Mathematical Methods of Image Processing
• Basic edges | Laboratory of Mathematical Methods of Image Processing