Production of kink ­ antikink pair in collisions of high­energy par ticles Dmitry Levkov , Sergei Demidov Institute for Nuclear Research RAS demidov @ms2.inr.ac.ru August 22, 2009 D. Levkov , S. Demidov (INR RAS ) Production of kink ­ antikink pair August 22, 2009 1 / 12 Introduction Topological solitons in weakly coupled theories (1 + 1) V() 1 S= 2 g dxdt (µ )2 /2 - V () =c=1 ...

Еще в разделе: (Показать все результаты (>106) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/Peshekhonov.pdf
• http://nuclphys.sinp.msu.ru/mirrors/1999_12.pdf
• http://nuclphys.sinp.msu.ru/mirrors/2001_2c.pdf

The Octotron Approach: Towards Autonomous and Reliable Operation of Supercomputers Alexander Antonov, Dmitry Nikitenko, Pavel Shvets, Sergey Sobolev, Konstantin Stefanov, Vadim Voevodin, Vladimir Voevodin, Sergey ... @parallel.ru Research Computing Center, M.V.Lomonosov Moscow State University, Moscow, Russia Project Goals · to discover all types of failures in supercomputers as well as their root causes and relationships; · to react automatically to any ... Model-based Approach Benefits 1. ...

Еще в разделе: (Показать все результаты (>26) - hpc.msu.ru/ )

• http://hpc.msu.ru/files/HPC/ISC_2015_Posters_attachment_14.pdf
• AlgoWiki: an Open Encyclopedia of Parallel Algorithmic Features. From Mobile to

... CC Large Hall, Chair G. Passarino . ... Parallel Session, 15:00 - 18:30 . ... A. Vaniachine, Data challenges in ATLAS (ID=524) 30 min . ... 15:00 - 16:20 (each talk of 20 min), Chair G. Ososkov . L. Litinskii, Optical Neural Network Based on the Parametrical Four-Wave Mixing Process (ID=233) . ... G. Ososkov, Effective Training Algorithms for RBF-Neural Networks. ... Orlov, Neural Network Approach to Discovering Temporal Correlations (ID=292) Parallel Session, 15:00 - 18:10, 25 June . ...

Еще в разделе: (Показать все результаты (>36) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/leftpanel.html
• http://acat02.sinp.msu.ru/tut4.html
• http://acat02.sinp.msu.ru/tutor.html

... Программа на май 2004 г. 26 мая - два доклада: . ... Error Bounds for Edgeworth and Cornish-Fisher Expansions of MANOVA Test Statistics. ... In this talk we give theoretical accuracy for asymptotic expansions of the distributions of two MANOVA test statistics: . T_{LH}=T_0^2=n \tr S_hS_e^{-1}, \quad T_{LR}=-n \log (|S_e|/|S_e+S_h|), . ... Our main purpose is to derive error bounds for the asymptotic expansions. ... We also discuss about theoretical accuracy for their Cornish-Fisher expansion. ...

Еще в разделе: (Показать все результаты (>35) - new.math.msu.su/ )

• Department of Probability Theory

Call Title: Call for proposals for ERC Starting Independent Researcher Grant Call identifier: ERC -2012-StG Date of publication: 20 July 2011 Electronic proposal submission deadlines1 (single submission of full proposal): 2 Domain Physical Sciences Engineering (Panels PE1 - PE10): 12 October 2011, 17.00.00 (Brussels local time) Domain Life Sciences (Panels LS1 ­ LS9): 9 November 2011 17.00.00 (Brussels local time) Domain Social ... See section 4.6 and Annex 9 of the work programme. ...

Еще в разделе: (Показать все результаты (>29) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/H2020Calls1.doc
• http://ideas.msu.ru/news/19_10_2010/Press_release.pdf

... Custom Query . ... Component . ... automata io requirements ui . ... And љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Owner Type Status Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>30) - kodomo.cmm.msu.su/ )

• Custom Query в?' Cyclyc Cell Automata
• Index of /~dendik/data/python
• Index of /~dendik/data/python/2010-03-17

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>5) - depository.msu.ru/ )

. Add . News . News archives . Please, input password . Date of new . Day . Month . Year . Date of the end of new . Day . Month . Year . Input text . Description of file1: . Description of file2: . Description of file3: .

Еще в разделе: (Показать все результаты (>5) - lcc.chem.msu.ru/ )

• History

... Sergei A. Astafief Ph.D., associate professor, Economics, Investment Management and Real Estate Management Department, Baikal State University of Economics and Law. ... Various participants of the market, try to solve the problems of construction of a rating of subjects of market economy. One of the responsibilities of Federal Service of Statistics is creating a rating of the enterprises on the basis of the statistical information received from them. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>62) - ee-journal.spa.msu.ru/ )

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>10) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/acceptance_bamberg2011-1.pdf

T he student body is the central group of the Faculty of Physics. ... The Faculty offers its students the widest choice of training programmes and majoring opportunities. ... C urrently there are about 40 general courses and over 650 specialized courses delivered covering a wide range of traditional and new areas of physics research. ... F rom the first year students can be trained under two programs physics or astronomy. ... T here is a specific education system in place at the Faculty of Physics. ...

Еще в разделе: (Показать все результаты (>12) - foroff.phys.msu.ru/ )

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.ru Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.ru/ )

• Index of /mash/os/2014 2015
• Index of /mash/os/2015 2016
• Index of /mash/os/About Lab

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.su Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.su/ )

• Index of /mash/os/2014 2015
• Index of /mash/os/2015 2016
• Index of /mash/os/About Lab

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... Laboratory of Mathematical Methods of Image Processing . ... Human identification by iris recognition is more reasonable than by finger-print or face detection, because the iris image is more random than faces or fingerprints. ... In our work, Hermite projection methods are used for human iris identification. ... Projection phase only correlation method for iris recognition // In: Proceedings of 13-th International Conference Digital Signal Processing and its Applications (DSPA'2011) , Vol. ...

Еще в разделе: (Показать все результаты (>38) - imaging.cmc.msu.ru/ )

Name Last modified Size Description . Parent Directory - Bozhenko-et-al-1101.2576v1.pdf 07-Mar-2011 15:01 70K Mishchenko-Morales-Trudy-G-bundle-Description-2011-02-28.pdf 01-Mar-2011 17:11 389K Mishchenko-Ribeiro-1102.5698v1.pdf 07-Mar-2011 15:02 80K . Apache/2.2.10 (Linux/SUSE) Server at higeom.math.msu.su Port 80

Еще в разделе: (Показать все результаты (>226) - higeom.math.msu.su/ )

• Index of /~asmish/Lichnaja-2010/Version2010-11-20/UchProcess-2009
• Index of /people/ssmirnov/pics/jdm/Austria
• Index of /people/ssmirnov/pics/jdm/Spain

... Research programm of the laboratory-chair< . ... Laboratory-chair of Discrete mechanics on a microscopic scale . ... Thus the structures of the physical world are not physical objects but physical processes. ... The primitive entity is called a material point. ... The value of the property “existence” of the material point varies from “the material point does not exist” to “the material point exists” by this process. ... Let call this structure a dynamical graph or a d-graph. ...

Еще в разделе: (Показать все результаты (>251) - chronos.msu.ru/ )

• Library of Electronic Publications
• Laboratory-chair of causal mechanics
• Laboratory-chair of modelling the natural references of time

. Name . Last modified . Size . Description . Parent Directory . - . Lecture_20100301.pdf . 2010-03-23 11:15 . 4.3M . Lecture_20100309.pdf . 2010-03-23 11:15 . 776K . Lecture_20100315.pdf . 2010-03-15 17:14 . 343K . Lecture_20100322.pdf . 2010-03-23 11:16 . 7.1M . Regatta_metodichka.doc . 2010-03-12 18:02 . 78K . assignment.pdf . 2010-03-29 13:53 . 177K . Apache/2.4.10 (Debian) Server at angel.cmc.msu.ru Port 80

Еще в разделе: (Показать все результаты (>2) - angel.cmc.msu.ru/ )

... file but would like it to be automatically updated # again, run the following command: # sudo dpkg-reconfigure -phigh xserver-xorg Section Files EndSection Section InputDevice Identifier Generic Keyboard Driver kbd Option CoreKeyboard Option XkbRules xorg Option XkbModel pc105 Option XkbLayout us ...

Еще в разделе: (Показать все результаты (>19) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>3) - belyakov.imec.msu.ru/ )