... Acoustic Emission and Seismic Emission Monitoring of the Foundation of Hydroelectric Power Station Located on Soft Soils . ... If elastic waves are to be propagated in a medium with inhomogeneities (localized defects, stratification, cracks) the characteristics of the information signal, for example, velocity of propagation, amplitude, and spectral contents, can change their parameters [1]. ... These characteristics are processed with a specially developed algorithm. ...

Еще в разделе: (Показать все результаты (>348) - acs366.phys.msu.su/ )

... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>185) - www.genebee.msu.ru/ )

• OUTPUT
• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help

Identifiability analysis and predictive power of the gene circuit model Ekaterina Myasnikova St.Petersburg State Polytechnical University, 29 Politekhnicheskaya, 195251, St.Petersburg, Russia, e-mail: myasnikova@spbcas.ru The correct prediction of system behavior is a necessary property of a mathematical model that is largely determined by the identifiability of model parameters. The number of parameters that are estimated by fitting to experimental data is typically large. ...

Еще в разделе: (Показать все результаты (>245) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/16.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/24.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/49.pdf

... 1.2 Free-electron lasers . 1.3 Historical development of the XFEL . References . ... 2.3.5 Experience form the first user operation periods . ... 3 General layout of the XFEL Facility . ... 3.4 Beam distribution system . ... 4 XFEL ccelerator . ... 4.4.2 Space charge and coherent synchrotron radiation effects . ... 4.8.2 Layout of the XFEL synchronisation system. ... 5.1.1 Principles of XFEL operation . 5.1.2 Design criteria for the European XFEL . ... 6.1 Overview of the X-ray systems . ...

Еще в разделе: (Показать все результаты (>198) - nuclphys.sinp.msu.ru/ )

. This is a framed page, but your browser doesn't support frames. Get FireFox!

Еще в разделе: (Показать все результаты (>233) - lnfm1.sai.msu.ru/ )

• IMCCE-SAI: Natural Satellites Service. Parameters and constants
• The determination of parameters of the gravity anomalies sources
• Data bases of Natural Satellites. Documentation. Manual

... The results will be also sent to you via E-MAIL to address: sherlock1991@rambler.ru . ... BRAJA MATITAAMVKDLRESTGAGMMDCKAALTENDGNMEAAQDWLRKKGLSKAA BURCA MAAITASMVAELRAKTDAPMMECKKALTEADGDLAKAEELLRVKLGNKAS RALPJ MAAITASMVAELRAKTDAPMMECKKALTEAEGNLEKAEEILRVKLGNKAG VIBCH -MAVTAALVKELRERTGAGMMECKKALVETNGDIELAIENMRKSGAAKAA VIBFM MATVTAALVKELRERTGAGMMECKKALVEANADIELAIENMRKSGAAKAA ECOLI MAEITASLVKELRERTGAGMMDCKKALTEANGDIELAIENMRKSGAIKAA PROMH MSGITAALVKELRERTGAGMMECKKALVEANGDIELAIDNMRKSGQAKAA ...

Еще в разделе: (Показать все результаты (>2612) - kodomo.cmm.msu.ru/ )

• Petri dish
• WikiProcessors тАУ Tanchiki
• Help in EMBOSS

DESCRIPTION OF THE TIME PROFILES OF KEY GEOMAGNETIC AND SOLAR WIND PARAMETERS . Time profiles of key geomagnetic parameters ( Ap and Dst indices) are shown together with key parameters of the solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM coordinate system). ... High time resolution data on the solar wind plasma is obtained from Wind experiment in 1997 and ACE experiment in 1998-2002 using ISTP data base . ...

Еще в разделе: (Показать все результаты (>10) - dbserv.sinp.msu.ru/ )

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ?GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY? aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>217) - www.geogr.msu.ru/ )

• CONTENTS ? 6 - 2012
• CONTENTS ?2 - 2009
• CONTENT 2?(8)?2015

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>42) - biochem.bio.msu.ru/ )

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

NUMERICAL METHOD OF SOLUTION OF PROBLEM STOCHASTIC LINEAR DIFFERENCE EQUATIONS PARAMETERS IDENTIFICATION IN CASE HANDICAPES ARE AVAILABLE IN INPUT PREDICTORS Pechekhonov A.N., Kacuba O.A. (Samara) The article is touching upon the problem of numerical algorithm designing for solution of the problem of stochastic linear difference equation parameters identification on the basis of non-linear method of least squares. ... 10, 2002, .399-401 G ґ . ... V N ( ) = 0 ^ ^ (3) min ( ) ; 2). ...

Еще в разделе: (Показать все результаты (>252) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc150931/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc15829/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc24959/eng.pdf

$row[1]\n"; } mysql_free_result($res); ?> $y\n"; } ?> $p_rus) { if ($p==$parameter) $value = "$p selected"; else $value = "$p"; echo " Нет станции под таким именем.\n \n"; exit(); } if ($address) echo " . $address . \n"; if ($parameter == 'all') { $query = "SELECT harshness from data WHERE station=$station AND YEAR(date)=$year LIMIT 1"; } else { $query = "SELECT $parameter from data WHERE station=$station AND YEAR(date)=$year LIMIT 1"; } $res = mysql_db_query("$db_name", $query); echo "

55. IMCCE-SAI: Natural Satellites Service. Parameters and constants

56. VaST homepage