... Manuscripts submitted to the journal should be divided into the following sections: Title page, Abstract (in Russian and English), Key words (in Russian and English), main manuscript text, list of references, tables, figures and figure captions. ... Full size of the article includes list of references, tables and figures. ... Rich text format (*.rtf) . ... References are given in the text in square brackets; full references are given at the end of the manuscript in the section List of references. ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/rukop_eng.doc
• http://www.antropos.msu.ru/zzx/11_2_en.doc

... The aim of the journal is the on-line publication of original papers in the field of numerical mathematics and its applications (for more details, see the scope of the journal). ... methods and algorithms of numerical mathematics and its applications for solving problems in science and technology; . ... Papers that deal with the development of new numerical methods and algorithms for solving problems of numerical mathematics and its applications correspond to the first subject area of the journal. ...

Еще в разделе: (Показать все результаты (>609) - num-meth.srcc.msu.ru/ )

• "Generation of semantic analyzer tests"
• "Generation of cycles of map cells for a simple planar graph"
• A modified generalized residual method for minimization problems with errors of

Moscow State University . Physics Department . ... Home :: History of Research :: Introduction The beginning of research in crystal physics at Moscow State University is associated with the names of the Academician V.I.Vernadsky and the Corresponding Member of the Academy Yu.V.Wulff who worked there at the turn of the century [1,2]. ... Lecture in Crystal Physics. ... A.V.Shubnikov. ... History of Research in Crystal Physics at the Chair of Crystal Physics of Moscow State University in 1953-1993. ...

Еще в разделе: (Показать все результаты (>219) - polly.phys.msu.ru/ )

... The paper must be written in English, should be no longer than 15 pages including references, and formatted according to this stylesheet. ... The first line of each paragraph should be indented by 0.63 cm except for paragraphs that follow a white space (e.g., after a heading, example, table or figure). ... 2.6 Pagination There should be no orphaned example numbers, that is, example numbers with corresponding text on the following page; page breaks in definitions or between examples and glosses, etc....

Еще в разделе: (Показать все результаты (>396) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/fdsl/FDSL7.5-stylesheet.pdf
• http://www.philol.msu.ru/~rkigf/P_Objavlenija/Konferencii/Konferencii_2011/2011_09_Grec_form2011.pdf
• http://www.philol.msu.ru/~otipl/SpeechGroup/publication1/bab_kr_00.doc

... Parsimony method . ... It is based on the following principle: the ancestral sequences (posed in nodes of a phylogenetic tree) should be such that the minimal required number of character replacements on the branches of the tree is less than for any other choice of sequences. ... If the preliminary character of the node is * , but the output character of its immediate ancestor is some letter (say, X ), and its set of possible characters contains X , then the output character of the node is also X . ...

Еще в разделе: (Показать все результаты (>1297) - monkey.belozersky.msu.ru/ )

• Inquiry information || Rule of four sequences
• Yeast intein-encoded LAGLIDADG homing endonucleases
• SDPpred

... Science . ... lrm@cs.msu.su . ... The Laboratory of Difference Methods was founded by A.A.Samarsky, Academician of RAS, in the middle of the 60s. For more than 50 years the Laboratory?s theoretical research has been focused on numerical methods for problems described by systems of partial differential equations. ... N.V.Ardelyan, V.L.Bychkov, I.V.Kochetov and K.V.Kosmachevskii, Non-self-maintained discharge plasma in propane-air mixture // IEEE Trans. on Plasma Science, vol. 39. no. 12, part 1, pp. ...

Еще в разделе: (Показать все результаты (>259) - en.cs.msu.ru/ )

• Laboratory of Difference Methods
• Open Laboratory of Information Technologies | CMC MSU
• Laboratory of Industrial Mathematics

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>132) - srcc.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Authors are asked to follow the instruction to authors published in the Journal "Phytopathology" (1995, vol.85. No.l, pp.7-10) before submission a manuscript. Here is its concise translation into Russian together with the details required by this journal and those are different from "Phytopathology". Authors are urged to read very carefully all paragraphs of the instruction following below to save much unnecessary work and avoid delay in publication. ... Papers should be in English. ...

Еще в разделе: (Показать все результаты (>6253) - herba.msu.ru/ )

• Материалы к полевому сезону
• The employment of quantitative methods for the lake ecosystem research

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>4) - tex.bog.msu.ru/ )

... Thus, the development of a method of synthesis of signals of finite duration, optimal in the sense of maximum concentration of energy in specified frequency ranges, is the actual problem. ... Erik Larsen, Ronald M. Aarts, "Audio Bandwidth Extension: Application of Psychoacoustics, Signal Processing and Loudspeaker Design", John Wiley & Sons, ISBN: 0-470-85864-8, September 2004. ... Time-frequency decomposition, 2. ... Shaping of the energy spectrum envelope of high-frequency content, 4. ...

Еще в разделе: (Показать все результаты (>606) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2010.PRIA.Nasonov_Krylov.Metrics.en.pdf
• http://imaging.cs.msu.ru/pub/2012.PRIA.Nasonov_Krylov.EdgeMetrics.en.pdf
• http://imaging.cs.msu.ru/pub/2011.PRIA.Nasonov_Krylov.Areas.en.pdf

... Effective Presentations . ... Read the following abstract and summarize the main points . ... And on a personal level, the ability to move the audience can shape the trajectory of a manager's career. ... You may open the presentation with a joke to get the audience's attention. Even if you write out your entire speech beforehand, you'll undoubtedly work to sound informal and conversational, possibly posing a few questions directly to the audience throughout the talk. ... Subject / title of talk. ...

Еще в разделе: (Показать все результаты (>24) - anazarenko.ffl.msu.ru/ )

... The basic core of the COMAGMAT-5.2 (2013) program includes the algorithm that has been used in previous versions of the COMAGMAT model (ver. 3.0-3.5) designed to simulate mafic magma crystallization processes . ... Ariskin A.A., Bychkov K.A., Danyushevsky L.V., McNeill A.W., Barmina G.S., Nikolaev G.S. (2012) COMAGMAT-5: a new magma crystallization model designed to simulate mafic to ultramafic sulfide-saturated systems. ... Contact ariskin@geokhi.ru . ... Ariskin A.A., Barmina G.S., Frenkel M.Ya., ...

Еще в разделе: (Показать все результаты (>607) - geo.web.ru/ )

• Mineral Drawings site. Books,references,aesthetical genetic mineralogy
• Informal geological society (RSG SG )

Staff :: Strogalov Alexander Sergeevich :: Publications of A.S.Strogalov . ... Some requirements are settled to educational computer systems and there is given a description of the main units of the real acting educational system "IDEA for Windows" developed on the theoretic investigation results of authors' association . ... The structure and principles of the main units acting of computer educational system "IDEA for Windows" using expert system as "computer teacher" is described below. ...

Еще в разделе: (Показать все результаты (>108) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Интеллектуальные системы :: Сотрудники :: Гасанов Эльяр Эльдарович :: Instantly
• Intelligent Systems :: Science :: Conference

This page briefly describes the texture filtering modes implemented in the current release of PolyWorld Engine. The following is a sample MIP-map texture generated from a regular 256x256 texture map. ... This map is usually referred to as a 4D Pyramid Anisotropic Filtering map. Only one, isotropic integer MIP level is calculated (MIP u = MIP v ). ... Unlike the Bilinear Filtering case shown above, rational isotropic MIP level is calculated . ... color = lrp (color1, color2, frc_MIP); . ...

Еще в разделе: (Показать все результаты (>39) - www.kge.msu.ru/ )

... Course ?Microcontroller Programming? is presented in two formats: . 32-bit microcontrollers . ... Acquired skills: practical skill of microcontroller programming on C; working with standard peripherals such as UART, digital display, ADC, pulse-width modulator, timer, etc. ... The duration of each special course within the frames of this program is two semesters. Each semester has 12 obligatory classes of four (4) academic hours each once a week, which totals in 48 hours per semester. ...

Еще в разделе: (Показать все результаты (>58) - engineering.phys.msu.ru/ )

• Introduction to Linux
• Circuit Diagnostics
• FPGA Design

TITLE OF THE ABSTRACT FIRST I. AUTHOR1, SECOND I.J. AUTHOR2 AND THIRD AUTHOR2 1Organization name of the first author first_ author@email.ru 2Organization name of the second and third authors second.author@email.com, third_author@mail.eu Key words: list up to eight words or group of words in order of priority, separated by commas. ... The abstract including figures, tables and reference should not exceed 1 page. The title should be centered in the page, in 11pt, boldface Roman, all capital letters. ...

Еще в разделе: (Показать все результаты (>23) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/Template.doc

New GCVS Version (GCVS5) FileName Explanations ----------------------------------------------------------------- ReadMe This file GCVS5 The ... ------------------------------------------------------ 1- 2 I2 --- Constell [1/88]Constellation numeric code 3- 6 I4 --- Number Star number within the constellation 7 A1 --- Component *Component identification 9- 18 A10 --- GCVS * Variable ... Field is non-blank if magMin is a magnitude or amplitude given in a system other than that indicated by magCode. ...

Еще в разделе: (Показать все результаты (>110) - sai.msu.ru/ )

• http://www.sai.msu.ru/groups/cluster/gcvs/gcvs/v/sn.txt
• http://www.sai.msu.ru/groups/cluster/gcvs/gcvs/nl75/IBVS2.STY
• General Catalogue of Variable Stars: References

... A direct current with a surface density of jmax ~ 103 A/cm2 violates the symmetry of the electron distribution function and induces the optical second harmonic with an intensity corresponding to the dipole quadratic susceptibility (2)d( jmax) ~ 3 в 10­15 m/V. PACS numbers: 7.57.Lm, 76.60.-k DOI: 10.1134/S0021364009020027 The surface nonlinear optics of centrosymmetric media is a rapidly developing line in diagnostic nonlinear optics. ...

Еще в разделе: (Показать все результаты (>147) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/afinogenov_shg.pdf
• http://nanolab.phys.msu.ru/sites/default/files/dd15_shilkin.pdf
• http://nanolab.phys.msu.ru/sites/default/files/paper_hybrid.pdf