... Ephemerides . ... Natural Satellites Data Center service. ... Please complete the form below, fields marked with * should be filled. See List of keywords for object List of keywords for subject Main journals list . ... by Keywords Title Title, Keywords and Abstract Authors Journal/Livre/Rapport: . ... AND OR NOT Exact sentence (within this field) AND . ... AND OR NOT Exact sentence (within this field) . ... Keywords . ... AND OR NOT Exact sentence . within this field) . ...

Еще в разделе: (Показать все результаты (>189) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure

The Chair of Mathematical Theory of Intelligent Systems and . ... Staff . ... Babin Dmitry Nikolaevich was born on September 2, 1954 in Baltijsk, Kaliningrad Region. ... He has fundamental results in the theory of automata and functional systems, as well as in pattern recognition theory. ... In 1987 D.N. Babin proved the theorem about existence of complete systems of arity two for finite automata (analog of 13th Hilbert's problem). ... Babin D.N. Undecidebility of problem of completeness . ...

Еще в разделе: (Показать все результаты (>101) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Zhuk Dmitriy
• Intelligent Systems :: Science :: Conference :: VIII International Conference
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

. This is the complete list of member functions and enum types for QNPStream , including all inherited members. QNPStream . complete . end . instance . lastModified . okay . requestRead . seekable . setComplete . setOkay . type . url . write . ~QNPStream . Copyright © 1998 Troll Tech . Trademarks . Qt version 1.40

Еще в разделе: (Показать все результаты (>490) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - application/application.cpp example file
• Qt Toolkit - QNPStream Class
• Qt Toolkit - QXtWidget member list

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>101) - hist.msu.ru/ )

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>21) - angel.cs.msu.su/ )

Open Conference Systems . ... All Authors Title Abstract Index terms Full Text . ... Conf. on Lasers, Applications, and Technologies > About the Conference > Submissions . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...

Еще в разделе: (Показать все результаты (>153) - hea.phys.msu.su/ )

• Call for Papers

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>100) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

Geology at Moscow State University . ... Our adjunct Professors . ... The faculty permanently extends the contacts with many overseas universities. The graduator of 1991 Artem R. Oganov who completed his PhD degree in University of London and now works as a leader of the group in ETH (Zurich) was recently nominated by the Faculty Scientific Council as an adjunct Professor. Prof. Dr. Artem R. Oganov . ... 2) Adjunct Professor, Geology Department, Moscow State University, Moscow 119899, Russia. ...

Еще в разделе: (Показать все результаты (>56) - www.geol.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>4662) - kodomo.fbb.msu.ru/ )

• allpy: log

University Satellites and . Space Science Education . ... Abstract Submission List of submitted abstracts . Registration List of registred participants . ... Today was a complete loss, 1985 cab club ford free wallpaper, . ... The list of abstracts submited . Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6699) - cosmos.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>172) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>18) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>182) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• Formatting
• Module Index - Apache HTTP Server

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>319) - uneex.lorien.cs.msu.su/ )

• Module Index - Apache HTTP Server
• Conditionals
• Real-World Package Building

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>63) - uneex.mithril.cs.msu.su/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... 1, 119899 Moscow, Russian Federation shamolin@imec.msu.ru ABSTRACT This work is devoted to the development of qualitative methods in the theory of nonconservative systems that arise, e.g., in such fields of science as the dynamics of a rigid body interacting with a resisting medium, oscillation theory, etc. ... References [1] M.V. Shamolin, Methods of Analysis of Dynamical Systems with Variable Dissipation in Dynamics of a Rigid Body [in Russian]. ...

Еще в разделе: (Показать все результаты (>39) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-136-1.pdf
• Maxim V. Shamolin Home Page

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>247) - www.philol.msu.ru/ )

• MSCL-3 | Call for Papers

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>2) - www.issp.ac.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )