... Motivations and Problems of Studying Time . ... Deepening of special scientific concepts . ... Measuring the age of natural systems . ... About relative concept of time . ... Problems of the typological concept of time . ... Biological Time, its Organization, Hierarchy and Presentation by Complex Values . ... Mathematical Temporal Constructions . ... Earth Sciences . ... Time As Variability of Natural Systems: Ways of Quantitative Description of Changes and Creation of Changes by Substantial Flows ....

Еще в разделе: (Показать все результаты (>452) - chronos.msu.ru/ )

• Laboratory-chair of modelling the natural references of time
• The Finite and the Infinite: A New view on the problem
• Russian Interdisciplinary Temporology Seminar

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>199) - lnfm1.sai.msu.ru/ )

• Manpage of FITSHDR
• Data bases of Natural Satellites. Documentation. Manual
• Труды Ширмина Г.И.

... The exercises cover the following areas: Session A covers three ways you can use ROOT: the command line, the script processor, and the graphical user interface (GUI). ... Session A: | ... Display |cern.ch/root/Atlfast.html| ... Use the ROOT command line . ... In a new session open the new ROOT file (altfast.root) and find the TFile method to print the compression factor: root[] TFile f("atlfast.root") root[] f.<TAB> 3: What is the size and compression factor of the generated file, atlfast.root? ...

Еще в разделе: (Показать все результаты (>63) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/huhlaev/Metamake.doc
• http://acat02.sinp.msu.ru/presentations/kolbasova/acat.pdf
• http://acat02.sinp.msu.ru/presentations/morhac/ACAT2002_Morhac_ID142.pdf

Contamination of soils and deeper sediments by toxic metals, metalloids, and radionuclides is a worldwide problem due to improper disposal practices, spills, atmospheric deposition of combustion emissions, and intentional application of sludges, fertilizers, or other materials. ... Microbial reduction of chromate, for example, may convert highly mobile Cr(VI) to less mobile Cr(III). In other cases, changes in metal redox state may be indirectly caused by microbial activity. ...

Еще в разделе: (Показать все результаты (>17) - eco.soil.msu.ru/ )

. Next: Abstract . On the problem of Super Ratio in Astrophysics . V.M. Lipunov . Sternberg Astronomical Institute, . Universitetskij pr., 13, 119899, Moscow V-234, Russia . E-mail: lipunov@sai.msu.ru . Abstract . Fermi's Paradox . Simple Universe . Tsiolkovskii's Paradox . Scientifically discovered God . Endlessly Complicated World . References . About this document ... Lipunov V.M. Sun May 3 16:35:20 MSD 1998

Еще в разделе: (Показать все результаты (>645) - xray.sai.msu.ru/ )

• Tsiolkovskii's Paradox
• xmgr: Help (draft)
• State of the problem

... 2015 . ... Administrative problems: theory and practice . ... Kudeev А.S., Tsilosani A.I. Implementation of corporate housing motivation programs through public-private partnership . ... Vasilyeva E.V. Problems of Regional Social and Demographic Management . Communication management and strategic communication in public administration . ... Communication Aspect of Terrorism and Counter-Terrorist Activities in Italy (2000-2012) . ... Legal and political aspects of public administration . ...

Еще в разделе: (Показать все результаты (>268) - ee-journal.spa.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>6) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>96) - comphep.sinp.msu.ru/ )

• faq [CompHEP]
• extra:main [CompHEP]
• overview [CompHEP]

... Zelikin Mikhail Ilych . Deputy Head of the Department . ... general theory of optimal control, homogeneous spaces and Riccati differential equations, qualititative theory of differential and finite-difference equations, integrable systems, differential games, optimal synthesis with chattering, minimization of multiple integrals. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>121) - new.math.msu.su/ )

• Scientific directions | Department: General Problems of Control. Faculty of
• Seminars of the department | Department: General Problems of Control. Faculty
• Current staff list | Department: General Problems of Control. Faculty of

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The Laboratory of Programming Technologies was established in 2001. The Laboratory's team consists of collaborators and graduate students of Computer System Automation Department that work under supervision of Professor Igor Mashechkin. ... series of works for research and development of multi-functional cross-programming system. ... Presently the main scientific direction of the Laboratory is research and development of algorithms and methods for creating data mining software. ...

Еще в разделе: (Показать все результаты (>140) - en.cs.msu.ru/ )

• Laboratory of Programming Technologies | CMC MSU
• Laboratory of Inverse Problems | CMC MSU
• Laboratory of Mathematical Problems of Computer Security | CMC MSU

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... This is a modification of the original Camera Calibration Toolbox for Matlab by Jean-Yves Bouguet that adds automatic calibration object detection to the functions of the original toolbox. ... The source code can be downloaded lower in this page. v0.31b Download GML Matlab Camera Calibration Toolbox 0.31 11.05.2005 Re-compiled and added correct OpenCV dlls . ... C++ Camera Calibration Toolbox . ...

Еще в разделе: (Показать все результаты (>245) - graphics.cs.msu.ru/ )

• GML LidarK Library | Graphics and Media Lab
• Keyframe-based Depth Compression (Update) | Graphics and Media Lab
• Saliency Map Estimation | Graphics and Media Lab

... M_K : Re: [News] Научное программное обеспечение [re:bmv] 26.09.2008 14:12 | ... 2D formatted math display : wxMaxima implements its own math display engine to nicely display maxima output. ... It adds support for mask transparency and adds new mask properties. ... The toolbox skeleton is now released into the public domain to facilitate the reuse of the code . ... R, like S, is designed around a true computer language, and it allows users to add additional functionality by defining new functions. ...

Еще в разделе: (Показать все результаты (>3433) - www.fds-net.ru/ )

• [linux] stardict and utf8 problem - Public forum of MSU united student networks
• Установка NVIDIA-Linux - Public forum of MSU united student networks
• Diablo2 Server Problem (to Plop) - Public forum of MSU united student networks

... GeneBee . ... Courses in Bioinformatics . ... What is GCG? ... Usage of GCG Package on GeneBee Server . ... What is WhatIf? ... Computer Class . ... Due to colaborate work of many laboratories the total length of published nucleotide sequences is now . ... GCG vs. ... Usage of GCG Package on GeneBee server . ... Computer class . ... Computer class is used for bioinformatic courses and for scientific semenars. ... Everyone who need a consultation for GeneBee service, GCG or WhatIf package is welcomed...

Еще в разделе: (Показать все результаты (>189) - www.genebee.msu.ru/ )

• BLAST 2.0 Release Notes
• BLAST Basic Overview
• MUSCLE User Guide

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

56. Katrich N.S.How can biodiversity decide ecological problems e-conference

57. The Center for Theoretical Problems in the Historical Sciences

58. http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-09-FPM-Diffuser.pdf

59. Re: Новинки программного обеспечения - Public forum of MSU united student

60. Tatjana Khruzina