... Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . ... Information on SCOP and Pfam domains presented in protein chains of structures is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... Scop families . List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>1079) - monkey.belozersky.msu.ru/ )

• Molecular biology databases

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>27) - dbserv.sinp.msu.ru/ )

... Полная версия этой страницы: Software Developer . Студенческий форум Физфака МГУ > Общий > Работа . Anastasiya . ... BroadVision QuickSilver enables you to create and publish lengthy, complex documents in multiple output formats (including HTML, PDF and Postscript) and automates publishing of personalized content to BroadVision Portal. Assemble publications from a variety of text, graphic and database sources, including Microsoft Word, AutoCad, Microsoft Excel, and Oracle. ...

Еще в разделе: (Показать все результаты (>280) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Чтение в массив строк
• Студенческий форум Физфака МГУ > PhD positions in Switzerland
• Студенческий форум Физфака МГУ > Ph.D and Post-Doc positions in chemical

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>26) - lcl.srcc.msu.ru/ )

... Status of the Institute . ... The International Society for the Study of Time . ... Helping researchers to understand the diverse implicit and explicit notions of 'time' that predominate in numerous scientific disciplines . ... The upkeep, management, support, enlargement, and improvement of the institute's virtual library: "Bibliokhronos" . The upkeep, management, support, enlargement, and improvement of the institute's catalogue of publications topically concerned with time studies . ...

Еще в разделе: (Показать все результаты (>416) - chronos.msu.ru/ )

This is the verbatim text of the qprogressdialog.h include file. ... creation of commercial/proprietary software. ** *****************************************************************************/ #ifndef QPROGRESSDIALOG _H #define QPROGRESSDIALOG _H #ifndef QT_H # include qsemimodal.h # include qpushbutton.h # include qlabel.h # include qprogressbar.h #endif // QT_H struct QProgressData; class QProgressDialog : public QSemiModal { Q_OBJECT public: ...

Еще в разделе: (Показать все результаты (>980) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - qgl.h include file
• Qt Toolkit - qwmatrix.h include file
• Qt Toolkit - qscrollbar.h include file

... The Workshop will take place in the city of Samara from September 4 till September 10, 1997. ... P.Baikov (INP MSU), E. Bashkirov (Samara Univ), A. Biryukov (Samara Univ), E. Boos (INP MSU), B. Danilyuk (Samara Univ), A. Demichev (INP MSU), M. Dubinin (INP MSU), M. Dolgopolov (Samara Univ.) P. Ermolov (INP MSU), A. Gorokhov (Samara Univ.) ... V. Savrin (chairman, INP MSU), A. Semenov (INP MSU), N. Sotnikova (INP MSU), N. Sveshnikov (INP MSU), V. Tarasov (INP MSU), I. Tsirova (Samara Univ.) ...

Еще в разделе: (Показать все результаты (>1357) - theory.sinp.msu.ru/ )

• QFTHEP'99
• QFTHEP'2004 Proceedings. Editors: M.N. Dubinin and V.I. Savrin. Preface
• Structure of LanHEP input file

... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...

Еще в разделе: (Показать все результаты (>31) - seac47-2.phys.msu.ru/ )

Unicode Support in Trac = [[TracGuideToc]] Trac stores all text using UTF-8 encoding, including text in tickets and wiki pages. ... To convert your database to UTF-8, the easiest way is to dump the database, convert the dump into UTF-8 and then import the converted dump back into the database.[ BR]] You can use [http://www.gnu.org/software/libiconv/documentation/libiconv/iconv.1.html iconv] to convert the dump. ... Ф?Ф?ХНХљФ? === English === Yes indeed, Trac supports English. ...

Еще в разделе: (Показать все результаты (>2814) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/trac/tanchiki/wiki/TracUnicode?version=1&format=txt
• TracUpgrade тАУ Tanchiki
• VIPERdb Database

... on the project . ... Laws on labour relations . Statistical and reference materials . Publications of the end of 19th - first three decades of 20th centuries . Publications of 1930s-1980s . Publications of the end of 20th - the beginnig of 21th centuries . Papers on the state regulation of labour relations . Bibliography on labour relations . ... Digitised images of archival and other historical documents . Electronic versions of archival and other documents . ...

Еще в разделе: (Показать все результаты (>183) - hist.msu.ru/ )

• Department of Southern and Western Slavic History
• Visual Images of Patriarch Nikon

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>71) - smdc.sinp.msu.ru/ )

• IGRF10 model - Space monitoring data center
• Paraboloid model of the Earth's magnetosphere - Space monitoring data center
• Coronas-I - Space monitoring data center

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>66) - electr003.chem.msu.ru/ )

... Salmonella typhimurium LT2, section... 147 9e-36 >AE008909 AE006468 |AE008909| ... Sbjct: 9915 aaacataaagtgatcgccagctgctttttcgaagcctc 9878 Database : fg Posted date: Dec 18, 2007 6:08 PM Number of letters in database : 12, 243 ,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 21,910 Number of extensions: 1351 ...

Еще в разделе: (Показать все результаты (>12734) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/hg/allpy/raw-rev/1edfb7e96cb4
• allpy: 2a5210791f43 Makefile
• allpy: 0010910571d3

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>6) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

INFORMATION BULLETIN No.1 . The Workshop continues a series of workshops started by the Skobeltsyn Institute of Nuclear Physics of Lomonosov Moscow State University in 1985 and conceived with the purpose of presenting topics of current interest and providing a stimulating environment for scientific discussions on new developments in theoretical and experimental high energy physics and physical programs for future colliders. ... Advisory Committee . ... J. Ellis (CERN, Geneva) . ...

Еще в разделе: (Показать все результаты (>161) - qfthep.sinp.msu.ru/ )

• Bulletins
• BULLETIN No.1
• INFORMATION BULLETIN No.2