MY GENERATION People try to put us d-down TALKIN' 'BOUT MY GENERATION just because we get around. ... TALKIN' 'BOUT MY GENERATION This is my generation, this is my generation, baby. ... TALKIN' 'BOUT MY GENERATION Yeah, don't try and dig what we all s-s-say. ... TALKIN' 'BOUT MY GENERATION Yeah, my generation, this is my generation, baby, generation, generation. People try to put us d-down TALKIN' 'BOUT MY GENERATION just because we g-g-g-get around. ...

Еще в разделе: (Показать все результаты (>14820) - crydee.sai.msu.ru/ )

• Additional problems at the transition
• Gaussian Chirplet
• Long description of list box example showing margins, padding, and borders

... The main principles of ARGENT, a new software package for multistage reaction design on the basis of the Formal-Logical Approach, are presented. ... The second paper describes the mathematical models (based on the theory of permutation groups) that form the foundations of the generation algorithm in ARGENT-1. ... In the third paper of the series, the actual generation algorithm used in ARGENT-1 is described. ...

Еще в разделе: (Показать все результаты (>734) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 43, No. 6, P. 381 (2002)
• Publications of the Laboratory of Spectroscopy Methods of Analysis
• Systematical Search for New Types of Chemical Interconversions: Mathematical

. Name . Last Modified . Size . Type . Parent Directory / . - . Directory . ChangeLog . 2016-Jan-25 18:56:30 . 1.3K . application/octet-stream . Manifest . 2016-Jan-25 18:56:30 . 1.8K . application/octet-stream . message_generation-0.3.0.ebuild . 2015-Sep-22 12:13:18 . 0.4K . text/plain . message_generation-9999.ebuild . 2015-Sep-22 12:13:18 . 0.4K . text/plain . metadata.xml . 2016-Jan-25 02:06:09 . 0.3K . text/xml . lighttpd/1.4.35

Еще в разделе: (Показать все результаты (>13238) - mirror.msu.net/ )

You can type MicroEMACS instructions in upper or lower case. There are two types of instruction, CONTROL and META. These are typed while holding down the CTRL key which is signified by the ^ character. ... These are typed after pressing the ESC key which is signified by M-. ... Remember, the CONTROL instructions are typed with the CTRL key and the META instructions are typed after the ESC key. Sometimes a META or CONTROL instruction will prompt you for more information. ...

Еще в разделе: (Показать все результаты (>113) - comet.sai.msu.ru/ )

. WINAMP . playlist . 11 tracks in playlist, average track length: 44:56 . Playlist length: 8 hours 14 minutes 19 seconds . Playlist files: DJ Skinner-Purple rose . m-NuClEaR - gobble-mix. HH2!!s . Nuclearsound . prick . m-NuClEaR - remember stritz . set . threedays . tssf-05171999-m3-gabbergirl . tssf-19990222-gabbergirl . tssf-19990422-Ozone-3-Gabbe . tssf-19990531-m3-gabbergirl . tssf-19991001-switchcraft-vandenbroek-56k . tssf-19991004-mcubed-gabbergirl . tssf-1999-djspree-mixtapeAside .

Еще в разделе: (Показать все результаты (>15) - optics.sinp.msu.ru/ )

• Our publications

О лаборатории . ... Лаборатория теоретической биофизики . ... The script generates nanotubes of arbitrary structure. ... To use it, save script to some file, then load into PyMol with the command: run /path/to/script.py . ... Here comes the script : # Nanotubes generating script for PyMol by piton at erg .biophys.msu.ru import cmd from math import cos,sin,pi,ceil,floor, acos from chempy import models, cpv class cell: def __init__(self ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>24) - erg.biophys.msu.ru/ )

• gromacs ERG Research Group: Лаборатория теоретической биофизики
• Peter Mamonov ERG Research Group: Лаборатория теоретической биофизики
• pymol ERG Research Group: Лаборатория теоретической биофизики

... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>11558) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• allpy: 1a8ddc6e2eee .hgignore
• allpy: 0b888869a4d8 .hgignore

... Query = swissprot|P0A7B8|HSLV_ECOLI ATP-dependent protease hslV; (176 letters) Database : orf 13 sequences ; 610 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value D89965_13 216 3e-61 D89965_5 15 1.4 D89965_13 Length = 125 Score = 216 bits (550), Expect = 3e-61 Identities = 113/ 125 (90%), Positives = 113/ 125 (90%) ...

Еще в разделе: (Показать все результаты (>2058) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~plazmoliz/Term3/sup/all_blastn.txt
• http://kodomo.cmm.msu.ru/~plazmoliz/Term3/sup/pyr_D.txt
• http://kodomo.cmm.msu.ru/~jesus_crist/iscs_to_3_e.txt

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>18) - comphep.sinp.msu.ru/ )

• download:rn-080423 [CompHEP]
• overview [CompHEP]
• download:rn-070606 [CompHEP]

... Key carbonatite localities that have been investigated as part of INTAS project 05-1000008-7938 ‘ Diamond and Graphite in Carbonate Magmas ’ are: (1) Western Greenland, where the distribution of kimberlites , lamproites and carbonatites is correlated with depth to a fossil subducted slab (personal communication, Nielsen 2008); (2) the Chagatai Complex of ... Generation of carbonatitic melt through partial melting of carbonated eclogite under mantle conditions. ...

Еще в разделе: (Показать все результаты (>277) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Lapin1.htm
• http://geo.web.ru/conf/alkaline/2009/Skufin.htm
• Database of Raman spectroscopy, X-ray diffraction and chemistry of minerals -

... Monitoring of population of rare orchid Epipogium aphyllum (F.W. Schmidt) Sw. on the isl. ... We counted generative shoots and flowers on them; we also checked the presence of pollinia in all flowers. We fixed four damaged by animals inflorescences (one flower, two flowers and two inflorescences with three flowers) with 70% ethanol to estimate the potential seed production. ... In the groups of generative shoots only one rhizome gave rise to the two generative shoots. ...

Еще в разделе: (Показать все результаты (>6036) - herba.msu.ru/ )

• Population of Epipogium aphyllum on the Kem’-Ludskij archipelago (White Sea)
• img_0816.jpg
• img_8966.jpg

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>361) - astro.uni-altai.ru/ )

... Directives | ... Apache HTTP Server Version 2.0 . ... This module controls the setting of the Expires HTTP header and the max-age directive of the Cache-Control HTTP header in server responses. The expiration date can set to be relative to either the time the source file was last modified, or to the time of the client access. ... access . ... If set to On , the headers will be added to served documents according to the criteria defined by the ExpiresByType and ExpiresDefault directives ( q.v. ). ...

Еще в разделе: (Показать все результаты (>193) - itpm.msu.su/ )

• IPC Keys
• mod_ext_filter - Apache HTTP Server
• What is a Mail Message?

Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...

Еще в разделе: (Показать все результаты (>16) - analyt.chem.msu.ru/ )

Generated by Foxit PDF Creator © Foxit Software http://www.foxitsoftware.com For evaluation only. 2011 1 Generated by Foxit PDF Creator © Foxit Software http://www.foxitsoftware.com For evaluation only. ... 1.3) dt dt dt dt d y d d d (1.4) a i x j k z . ... sin d (1.6) | ... 1.49) i 1 xi2 2. xi ; yi , i ­ n ( x1 , y1 ) , ( x2 , y 2 ) , ..., ( xn , y n ) , (1.50) y ax b , 22 Generated by Foxit PDF Creator © Foxit Software http://www.foxitsoftware.com For evaluation only. a ­ , , i2 ­ yi . ...

Еще в разделе: (Показать все результаты (>35) - genphys.phys.msu.su/ )

KEYWORDS: language evolution, mathematical modelling, branching processes . ... 2 Basic assumptions. ... Dying out, giving birth, and preserving of sign's meanings. ... Modelling of language evolution should be based on some assumptions concerning its micro-level, i.e. level of its micro-units' development. ... That is why it has become the starting point in the building of the mathematical model for the development in time and synchronic correlation of the whole system of a sign's features. ...

Еще в разделе: (Показать все результаты (>44) - old.philol.msu.ru/ )

This module provides for the generation of Expires HTTP headers according to user-specified criteria. ... This module controls the setting of the Expires HTTP header in server responses. The expiration date can set to be relative to either the time the source file was last modified, or to the time of the client access. ... ExpiresByType . ExpiresDefault . The ExpiresDefault and ExpiresByType directives can also be defined in a more readable syntax of the form: . ... Module: mod_expires . ...

Еще в разделе: (Показать все результаты (>42) - neptun.sai.msu.ru/ )

• Apache module mod_dir
• Apache module mod_usertrack
• Apache modules

Is multiple tґ-quarks bound states possible due to Higgs exchange? Oleg Pavlovsky and Maxim Ulybyshev (ITPM MSU & ITEP Moscow) tґ-balls: to be or not to be? 4-th generation is a natural extension of the Standard Model. 4-th generation quarks have hypothetical mass about several hundred GeV. ... If Fermion-Higgs interaction is strong enough it is favorable for quasi-massless quarks to be inside "bubble"-like soliton than to be free and massive. ... No soliton for one top-quark and for toponium! ...

Еще в разделе: (Показать все результаты (>137) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/mirrors/2001_2c.pdf
• http://nuclphys.sinp.msu.ru/school/s08/s08_15.pdf
• http://nuclphys.sinp.msu.ru/school/s09/09_47.pdf

CALCSYM - complex evaluator . ... CALCSYM.exe and CALCSYMi.exe will allow you to obtain numeric solution for *.out file generated by both CIRSYM and MATSYM programs (computation of freqency responces, unknowns, determinants, sensitivity analysis etc.. ... Setup file name for CALCSYM is "setup.cal". ... CALCSYMi.exe will allow you to work with long double over the range from 3.4*E-4932 to 3.4*E+4932. ... To calculate, run CALCSYM.exe and enter "file_name.OUT" or click on the "ENTER" (in "OUT" case). ...

Еще в разделе: (Показать все результаты (>13) - astrometric.sai.msu.ru/ )

• Astronomy
• Symbolic circuit processor
• Symbolic matrix processor