. Laboratory for Neurophysiology and Neuro-Computer Interfaces . M.V.Lomonosov Moscow State University . Faculty of Biology . EEG Records Databases . EEG Databases available: . EEG of healthy adolescents and adolescents with symptoms of schizophrenia . Event-related potentials in a moving matrix modification of the P300 BCI . Other databases will be available soon.

Еще в разделе: (Показать все результаты (>35) - brain.bio.msu.ru/ )

• EEG Database - Schizophrenia

... Hartree - Fock wave functions of atoms and ions . 1.1 Ground state (Z 18) (206 Tables) . 1.2 Ground state (Z 19) (216 Tables) . ... Configuration interaction wave functions of He-like ions . ... 2.3 (1snd) 1; D and (2p2p) 1; D (143 Tables) . ... 2.6 (1snd) 3; D (105 Tables) . ... 4.1 Hartree - Fock wave functions (290 Kb) . 4.2 Hartree - Fock wave functions of excited states (1.4 Mb) . 4.3 Configuration interaction wave functions of He-like ions (281 Kb) . ...

Еще в разделе: (Показать все результаты (>4910) - cdfe.sinp.msu.ru/ )

• CDFE provides the major photonuclear databases. Online Services.
• CDFE => Online Services => Relational ENSDF
• CDFE - Centre for Photonuclear Experiments Data - Home page

. The "Areola" system database . Bryzgalov P.A. The paper describes the database of the "Areola" system - a program shell for creating online encyclopedia. In particular, the database structure, the processes of initial data input, detecting errors and editing information in the database are described. PostScript (in Russian) (104KB) . PDF (in Russian) (108KB) . PostScript. zip (in Russian) (30.4KB) . PDF. zip (in Russian) (43KB) . Bryzgalov P.A. e-mail: pyotr777@guru.ru

Еще в разделе: (Показать все результаты (>83) - num-meth.srcc.msu.ru/ )

• "A hybrid database (information system) on the molecular spectral constants"
• "Updatable XML-views over relational databases"
• "Data structuring and formalization in the hybrid database on molecular

. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference

Еще в разделе: (Показать все результаты (>143) - herba.msu.ru/ )

• Moscow State University, Geobotany dpt. - View Staff

. Parent Directory . 00-index . bullet25.zip . cslio205.zip . db02.zip . dbf2msql-2.0.zip . dbf2mysql-1.10d.zip . dbf_edit1_0.zip . dbffg04b.zip . dbfin096.zip . dbi-1_02.zip . dbv05.zip . mbase205.zip . msql-bench.zip . msql-mysql-modules-1_2010.zip . msql207b1.zip . mysql-c.zip . mysql-client-3.22.26a.zip . mysql2-3.22.26a.zip . odb.zip . os2mb106.zip . postgres652.zip . postgres7.0.0-server-bin_os2.zip . viper092.zip . www-mysql-0.5.7.zip . xdbfj19a.zip

Еще в разделе: (Показать все результаты (>414) - crydee.sai.msu.ru/ )

• Work notes

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>93) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Sources
• Division of the Galaxy and Variable Stars
• Natural Satellites Data Center. Objectiv.

... Los-Alamos arXiv.org e-Print archive . xxx.itep.ru e-Print archive mirror . Algebraic Topology discussion list . ... Information about conferences . British Topology home page . maintained by Andrew Baker ) . ... Conferences and meetings on Topology and related topics . AMS " Math on the Web " resources: . Mathematics Department Web Servers . ... Zentralblatt MATH Database . ...

Еще в разделе: (Показать все результаты (>64) - higeom.math.msu.su/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>7) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>18735) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• http://kodomo.fbb.msu.ru/~element/Term3/gomolog.txt

SAI WWW-tools archive . Russian Web's server list . ... World Wide Web Consortium . ... WebStone - World Wide Web Server Benchmarking . ... Web/HTML Documentation and Developer's Resource . ... Nice links collection about World Wide Web . ... List of World-Wide Web Servers . ... Tim Dunn's Web Page, Take Two . ... World Wide Web Tools . ... NCSA Home Page . ... World Wide Web Server Performance . ... Curl - a tool for automatically generating the links between the HTML pages comprising a World . ...

Еще в разделе: (Показать все результаты (>106) - comet.sai.msu.ru/ )

• UNIXhelp Glossary - "D"
• Digitized Sky Engines
• Local Staff of RadioAstronomy Dept. of SAI

... History of chemistry (see, e.g., materials on the history of crystal chemistry and X-ray structural analysis (in Russian) and lecture materials for the course "History and methodology of chemistry" (in Russian)) . ... Crystal chemistry" for 4th year students of the Chemistry department of Moscow State University . ... Crystal chemistry and structural chemistry" for 3rd year students of the Faculty of Materials Science of Moscow State University (Yu.L.Slovokhotov, A.E.Obodovskaya, O.V.Grineva) . ...

Еще в разделе: (Показать все результаты (>221) - chem.msu.ru/ )

• Center of Scientific Information of the Chemistry Department of Moscow State
• Laboratory of inorganic synthesis
• Moscow University Chemistry Bulletin Vol. 52, No. 3, P. 175 (2011)

... extends CGI::Session::ErrorHandler . ... CGI::Session::Driver - CGI::Session driver specifications . ... To be more precise, driver is a F<.pm> file that inherits from CGI::Session::Driver and defines L<retrieve()|/"retrieve($self, $sid)">, L<store()|/"store($self, $sid, $datastr)"> and L<remove()|/"remove($self, $sid)"> methods. =head2 BLUEPRINT . ... sub store { my ($self, $sid, $datastr) = @_; my $dir = $self->{Directory}; # <-- in this example will be '/tmp/sessions' } . ... item init($self) . ...

Еще в разделе: (Показать все результаты (>28314) - dualopt1.cmm.msu.ru/ )

• CGISessionDriverDotPm - TWiki - TWiki
• CGISessionDriverDotPm - TWiki - TWiki - (printable)
• TWikiRegistration - TWiki - TWiki

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>11) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>47) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_anon.c
• Apache module mod_auth_db

... Departments . ... sp@cmc.msu.ru . ... The Department prepares specialists in information technologies with a more profound knowledge in the following areas: the general questions of software engineering and information security, architecture of the system software including operating systems, compilers, database management systems, the telecommunication software and middleware. ... Algorithms and programming languages by Prof. Gayssaryan and Dr. Belevantsev, 54 lecture hours and 72 seminar hours. ...

Еще в разделе: (Показать все результаты (>108) - en.cs.msu.ru/ )

• Department of Computing Systems and Automation
• Department of System Programming
• Department of Computing Systems and Automation | CMC MSU

... research . ... I'm a postdoc in the group of Mathematical Modelling , Institute for Chemistry and Biology of the Marine Environment (ICBM), . University of Oldenburg, 26129 Oldenburg, Germany . ... a.ryabov@icbm.de . ... Research Associate . ... Nonlinear Dynamics Group . ... Nonlinear Dynamics & Chaos Group . Moscow State University . ... Ph.D. in Nonlinear Dynamics, Moscow State University . ... Diploma work in Statistical Physics, Moscow State University . ... б©2009 Ryabov Alexey | ...

Еще в разделе: (Показать все результаты (>32) - chaos.phys.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> Guilty by Association . Пользователи . Демо . Деньги . Фильмы . Форум . Guilty by Association . Порочный круг . США 2003 . отметить . Криминальный . Драма . Боевик . Howard Gibson . Po Johns . Bryce . Jeff Edward . Morgan Freeman . Daemon Moore . Jaimie Patton . Queen Pen . Section 8 Mob . Bryce Wilson .

Еще в разделе: (Показать все результаты (>15) - kinfo.ru/ )

• Guilt by Association - Фильмы - Kinfo.ru
• Association de malfaiteurs - Фильмы - Kinfo.ru
• The Associate - Фильмы - Kinfo.ru

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Correlation Engine Portotype V.Pose, JINR Dubna B.Panzer-Steindel, CERN IT Overview The Correlation Engine Prototype was developed during a 3-month work in CERN IT Division financed by the CERN-Intas project. The CERN monitoring prototype, part of the fabric management work package (WP4) of the DataGrid project, gathers monitoring data from farm nodes in CERN into a central monitoring database. ... Two engines are implemented - ayt and procpu. ... connects to such a node using the ayt engine . ...

Еще в разделе: (Показать все результаты (>24) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/kodolova/acat.pdf
• http://acat02.sinp.msu.ru/poster-sessions.html

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>12) - ecfs.msu.ru/ )