... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>338) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 48, No. 2, P. 86 (2007)
• Dielectric Properties and Molecular Structure of the Liquid Unsaturated
• Exciplex Mechanism of Excited-State Electron Transfer Reactions

. [ Войти ] . Главная -> Фильмы -> Complete Savages . Пользователи . Демо . Деньги . Фильмы . Форум . Complete Savages . США 2004 . отметить . Сериал . Комедия .

Еще в разделе: (Показать все результаты (>104) - kinfo.ru/ )

• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• The Completely Mental Misadv.. - Фильмы - Kinfo.ru
• Vacuuming Completely Nude in.. - Фильмы - Kinfo.ru

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>19) - engineering.phys.msu.ru/ )

• Introduction to Linux
• Parallel Programming

... Reduction of detailed schemes for chemical transformations of formaldehyde and hydrogen oxidation reactions based on a sensitivity analysis of a mathematical model" . ... The results of simulation are compared in the case of using a number of reduced and detailed schemes for formaldehyde and hydrogen oxidation reactions. Keywords: sensitivity analysis, mathematical model of reaction, formaldehyde oxidation reaction, hydrogen oxidation reaction, reduction of chemical reaction mechanisms. ...

Еще в разделе: (Показать все результаты (>182) - num-meth.srcc.msu.ru/ )

• "Calculation of optimal coefficients for quadrature formulas by the complete
• "Application of the Quickhull algorithm's principles to the double description
• "TreeDL: a language for description of graph structures and operations on them"

... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...

Еще в разделе: (Показать все результаты (>292) - monkey.belozersky.msu.ru/ )

• SCOP classification
• Homeodomain numeration assumed

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>24) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

Comparative metabolomic profiling of desiccation tolerant midge Elena Shagimardanova, T. Kikawada and O. Gusev Kazan Federal University, Kazan, Kremlevskaya str, 180pt), rjyka@mail.ru T. Kikawada National Institute of Agrobiological sciences, Tsukuba, Japan, kikawada@affrc.go.jp O.A. Gusev RIKEN Preventive Medicine & Diagnosis Innovation Program (PMI), RIKEN, Yokoh ama, Japan, gaijin.ru@gmai.com There are organisms of different complexity, which can survive complete water loss conditions. ...

Еще в разделе: (Показать все результаты (>171) - mccmb.belozersky.msu.ru/ )

• MCCMB'13

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>248) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/TTC/slides/timashev-poster.pdf

... Method Detail protected final void init ( ConcreteIndexMap.ZZMap iMap, ConcreteIndexMap.ZZMap lengthsMap) . ... iMap - ZZMap defining the forward transform. protected final void link ( ConcreteIndexMap prev, ConcreteIndexMap.ZZMap iMap, ConcreteIndexMap.ZZMap lengthsMap) . ... prev - ConcreteIndexMap this is composed with. iMap - ZZMap defining the forward transform. lengthsMap - ZZMap defining the reverse transform. protected final void link ( ConcreteIndexMap prev, ConcreteIndexMap.ZZMap iMap) . ...

Еще в разделе: (Показать все результаты (>84) - angel.cs.msu.su/ )

• ExtensionFileFilter
• : Package ucar.netcdf
• : Package ucar.multiarray

T he student body is the central group of the Faculty of Physics. ... The Faculty offers its students the widest choice of training programmes and majoring opportunities. ... C urrently there are about 40 general courses and over 650 specialized courses delivered covering a wide range of traditional and new areas of physics research. ... F rom the first year students can be trained under two programs physics or astronomy. ... T here is a specific education system in place at the Faculty of Physics. ...

Еще в разделе: (Показать все результаты (>16) - foroff.phys.msu.ru/ )

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Virtual Observatory

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>97) - hist.msu.ru/ )

... education . research . ... Functional Nanomaterials . ... Composite Nanomaterials Master?s Program . educational program . ... MSU and RAS leading scientists have devised fundamental courses (approx. 20% of the program) to provide essential knowledge in composites, a number of novel lecture and practical courses (approx. 50% of the program.) ... After completion of the program and defense of Master?s degree papers, students receive Master?s degrees from MSU. ...

Еще в разделе: (Показать все результаты (>8) - nano.msu.ru/ )

• Announcement about the admission to MSU Graduate School for a new Master?s

DESCRIPTION OF THE 3d SOLAR EVENT MAP . ... This date coincides with central day of the map marked by solid vertical line (in the present example - 13 July, 2000). ... The following phenomena are presented on the map: coronal holes, filaments, solar flares and the distribution of the solar magnetic field on the source surface (2.5 solar radii). The coronal holes are drawn by irregular solid curves with colors according to the day of observation (light blue, orange and violet). ...

Еще в разделе: (Показать все результаты (>22) - dbserv.sinp.msu.ru/ )

• 1d Map Description
• Catalogue of Space Storms

NAME ab - Apache HTTP server benchmarking tool SYNOPSIS ab [ - k ] [ - i ] [ - n requests ] [ - t timelimit ] [ - c con- currency ] [ - p POST file ] [ - A Authenticate username : password ] [ - P Proxy Authenticate username : password ] [ - H Custom header ] [ - C Cookie name = value ] [ - T content - type ] [ - v verbosity ] [ - w output HTML ] [ - x table attributes ] [ - X proxy [:port] ] [ - y tr ... Default is no KeepAlive. - i Use an HTTP 'HEAD' instead of the GET method. ...

Еще в разделе: (Показать все результаты (>89) - neptun.sai.msu.ru/ )

• Manual Page: dbmmanage - Apache HTTP Server
• Manual Page: apachectl - Apache HTTP Server
• Apache module mod_autoindex

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>126) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

tppRENUM: 0.6.2 . tppMkTOP: 0.6.2 . Program allows you to renumber and rename atoms in your molecule in a nice way. Load PDB file for renumbering: . ... We strongly recommend you to read detailed description of TPPmktop functioning in TPPmktop description on ERG site . Please ensure, that your PDB file was made correctly. ... Load PDB file for making all-atom OPLS topology: . TPPRENUM runs: . TPPMKTOP runs: . ...

Еще в разделе: (Показать все результаты (>11) - erg.biophys.msu.ru/ )

• Quantum chemistry information page ERG Research Group: Лаборатория

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

.

40. Alexander Valeryevich Pozdneev