. PHP Manual . Prev . Next . (PHP 4 >= 4.0.0) readline_completion_function -- Registers a completion function . bool readline_completion_function ( string line) . This function registers a completion function. You must supply the name of an existing function which accepts a partial command line and returns an array of possible matches. This is the same kind of functionality you'd get if you hit your tab key while using Bash. Prev . Home . Next . readline_clear_history . Up . readline_info

Еще в разделе: (Показать все результаты (>550) - oit.cmc.msu.ru/ )

• yaz_wait
• apache_child_terminate
• Parser behavior

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Password: . ... Approximate price in Conference bookstall 200 roubles. You need to submit Conference application first to order books to Conference bookstall. If you have already registered just enter your username and password. ... 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>65) - www.mce.biophys.msu.ru/ )

... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...

Еще в разделе: (Показать все результаты (>580) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• SCOP classification
• About this project

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>195) - chem.msu.ru/ )

• Hot News. Russian XV International conference on chemical thermodynamics

... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>81) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)

Next: Using the Traditional NIS Up: The Network Information System Previous: Using the passwd and . There is no NIS support yet for sites that use the shadow login suite. ... On the other hand, publishing the information from /etc/shadow via NIS kind of defeats the purpose of the shadow suite. Although the NYS password lookup functions don't use a shadow.byname map or anything likewise, NYS supports using a local /etc/shadow file transparently. ...

Еще в разделе: (Показать все результаты (>363) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• The active file
• Formatting

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>7277) - mouse.belozersky.msu.ru/ )

• Geometrical core

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>93) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly and PC GAMESS Version History

... О UNИX . ... 07_UsingIPTables . ... базовые функции, классификация . ... +проброс порта): [root@srv ~]# iptables-save # Generated by iptables-save v1.4.18 on Fri Apr 4 14:38:01 2014 *mangle :PREROUTING ACCEPT [27:2118] : INPUT ACCEPT [27:2118] :FORWARD ACCEPT [0:0] :OUTPUT ACCEPT [20:2782] :POSTROUTING ACCEPT [20:2782] COMMIT # Completed on Fri Apr 4 14:38:01 2014 # Generated by iptables-save v1.4.18 on Fri Apr 4 14:38:01 2014 *nat :PREROUTING ACCEPT [0:0] : INPUT ACCEPT [0:0] ...

Еще в разделе: (Показать все результаты (>1506) - uneex.lorien.cs.msu.su/ )

• Getting Ready to Sign
• Real-World Package Building
• PspoClasses/080708/01IptablesTheory - UNИX

Calculation of optimal coefficients for quadrature formulas by the complete enumeration method" . O.V. Belen'kaya, Ya.M. Zhileikin, and A.B. Kukarkin . Optimal coefficients of number-theoretic quadrature formulas are calculated for the two-dimensional case by the complete enumeration method. Optimal coefficients obtained by several different methods are compared. PostScript (in Russian) (87.1KB) . PDF (in Russian) (114KB) . PostScript. zip (in Russian) (30.7KB) . ...

Еще в разделе: (Показать все результаты (>207) - num-meth.srcc.msu.ru/ )

• "Mathematical simulation of unsteady three-dimensional processes in the space
• A parallel multilevel nested dissection algorithm for shared-memory computing

... ON LANGUAGE . ... TOWARD THE LANGUAGE OF HAPPINESS . ...

Еще в разделе: (Показать все результаты (>133) - www.psy.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>548) - istina.msu.ru/ )

• Lohmann B. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Aloise S. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Kleiman U. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

This example program looks like a complete modern application. ... ApplicationWindow :: ApplicationWindow () : QMainWindow ( 0, example application main window ) { printer = new QPrinter ; printer- setMinMax( 1, 10 ); QPixmap openIcon, saveIcon, printIcon; fileTools = new QToolBar ( this, file operations ); openIcon = QPixmap( fileopen ); QToolButton * fileOpen = new QToolButton ( openIcon, Open File , 0, this, SLOT ( load ()), fileTools, open ...

Еще в разделе: (Показать все результаты (>726) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QLabel member list
• Qt Toolkit - QButtonGroup member list
• Qt Toolkit - QGroupBox member list

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>3425) - www.fds-net.ru/ )

• [Requests] У кого есть? - Public forum of MSU united student networks
• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student
• Хоккей ЧМ 2008 - Public forum of MSU united student networks

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>4) - www.pereplet.ru/ )

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>16) - foroff.phys.msu.ru/ )

... That segment of good times that have been forgotten . ... Forgotten times . Moore Memorial Church, 316 Middle Xizang rd. ... By 1925 it had 1200 followers. ... Two-story hall with wooden seats for choir, Gothic ceilings, arch window. ... Textured patterns and scarlet brick walls, windows graced by dark grey stone quoins. 42.1-meter high bell tower was one of the highest in the city, the church - was one of the largest in China at that time. ... To the sixth trip . ...

Еще в разделе: (Показать все результаты (>95) - lnfm1.sai.msu.ru/ )

• HSFA 2 technical description Technical Details

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>7) - lhe.sinp.msu.ru/ )

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>19) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc
• http://www.innovation.msu.ru/english/reportofinvention.doc