... 22/042008 15:16 edneral 22/042008 15:15 edneral 05/032008 10:33 edneral 31/012008 17:54 edneral 14/012008 15:14 admin 14/012008 15:11 admin Links to calg:calg changed to calg:main 14/012008 15:08 kryukov 14/012008 15:08 kryukov 16/112007 12:49 kryukov 16/112007 12:47 kryukov 16/112007 12:45 kryukov 16/112007 12:43 kryukov 19/042007 10:49 kryukov 14/032007 13:15 kryukov 11/012007 09:04 kryukov 13/122006 12:34 kryukov 13/122006 12:34 kryukov 13/122006 12:33 kryukov 10/102006 18:26 kryukov Go . ...

Еще в разделе: (Показать все результаты (>15564) - theory.sinp.msu.ru/ )

• [Computer_algebra] Computer algebra seminar (March)
• intas:cern-intas03:task6 [THEP]
• [Computer_algebra] CA Seminar on December 24

... Linux installation & system administration . ... There are a myriad of mailing lists that may prove helpful in providing answers to your questions as well. These can usually be found through a simple web search (for example, searching for ``linux raid mailing list'' might help you find mailing lists devoted to RAID issues under Linux). ... Description of available Red Hat lists: http://www.redhat.com/ . ... Description of available GNOME lists: http://www.gnome.org/mailing-lists/index.shtml . ...

Еще в разделе: (Показать все результаты (>577) - itpm.msu.su/ )

• ITPM MSU Web Page

... Course "Computer Physics" for 1st and 2nd year students of Physics . ... The audience is 1st and 2nd year students of Physics. ... It consists of a short lecture course, seminars, and a large number of computer labs. ... 1985-1994 : Lectured a specialized course on "Computer Physics"for the 3rd year students of Physics, Department of Physics, and attendees of the continuing education department, International Laser Center of Moscow State University. ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>99) - qilab.phys.msu.ru/ )

... Changed: . Plugin use and development; about the Plugin API. ... Everything to do with TWiki Plugins - demos, new releases, downloads, development, general discussion - is available at TWiki.org, in the TWiki.org Plugins web . ... The Application Programming Interface (API) for TWikiPlugins provides the specifications for hooking into the core TWiki code from your external Perl Plugin module. The Plugin API is new to the Production version of TWiki with the TWikiReleaseSpring2001. ...

Еще в разделе: (Показать все результаты (>50114) - dualopt1.cmm.msu.ru/ )

• BehaviourContrib - TWiki - TWiki
• %TOPICTITLE% (5 vs. 6) - TWiki
• UserDocumentationCategory - TWiki - TWiki

... Полная версия этой страницы: Работа в Samsung . Студенческий форум Физфака МГУ > Общий > Работа . ... Telecommunication Network . ... Job Summary: The Optical Engineer will be involved in the design, fabrication and testing of optical/digital imaging system for mobile devices. ... Required Skills: Must have proven optical design and algorithm skills, lens design experience using code-V or equivalent lens design software. ... Company: Samsung Electronics Telecommunication Network Business . ...

Еще в разделе: (Показать все результаты (>607) - wasp.phys.msu.ru/ )

• Работа в Samsung - Студенческий форум Физфака МГУ

International Laser Center of MSU . ... Scientific Laboratories . Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>795) - ilc.phys.msu.ru/ )

• "Computers and measurements" practical course laboratory
• Practice
• Publication

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>28) - comphep.sinp.msu.ru/ )

• faq [CompHEP]

Either several (at least two) Intel/AMD-based computers having identical or similar hardware configuration and running in the local network environment under the control of Windows NT 4.0, Windows 2000, Windows XP, Windows Server 2003, Windows Vista, Windows Server 2008, or Windows 7. ... The 32-bit NT-MPICH package (the part of MP-MPICH) must be installed, including MPI dynamic link libraries and cluster management service, on all computers to be used to run PC GAMESS/Firefly in parallel. ...

Еще в разделе: (Показать все результаты (>109) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - running in parallel using LAM/MPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using WMPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel Linux/MPICH binaries

... Master Education . ... Master programs . ... graduates for activities requiring in-depth fundamental and professional knowledge, including research in applied mathematics and computer technology, development and use of mathematical models for processes and objects, development and application of advanced mathematical methods and software to address problems in science, technology, economics and management.The Mathematical and Computational Methods of Image Processing ... master thesis...

Еще в разделе: (Показать все результаты (>138) - hcs.cmc.msu.ru/ )

• The core courses for the specialty "Applied Mathematics and Computer Science".
• Master program "Software for Computer Networks" | Магистерское и послевузовское
• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Research . ... 1976 – current: Moscow State University . ... Moscow State Institute of Foreign Languages (currently - Moscow Linguistic University), Translation Faculty, Department of Machine Translation . ... Degree granted through Moscow State University, Department of Structural and Applied Linguistics, V.A.Zvegintsev, Head . ... Russian State Humanitary University, Department of General and Applied Linguistics. ... Moscow State Linguistic University, Department of General Linguistics. ...

Еще в разделе: (Показать все результаты (>70) - lcl.srcc.msu.ru/ )

... GeneBee . ... Courses in Bioinformatics . ... What is GCG? ... Usage of GCG Package on GeneBee Server . ... What is WhatIf? ... Computer Class . ... Due to colaborate work of many laboratories the total length of published nucleotide sequences is now . ... GCG vs. ... Usage of GCG Package on GeneBee server . ... Computer class . ... Computer class is used for bioinformatic courses and for scientific semenars. ... Everyone who need a consultation for GeneBee service, GCG or WhatIf package is welcomed...

Еще в разделе: (Показать все результаты (>236) - www.genebee.msu.ru/ )

• INTAS :: Global and Local Protein Matching
• GeneBee
• BLAST Basic Overview

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>9) - asa.guru.ru/ )

... This document describes how to install and use a client for the commercial ADSM backup system for Linux/i386. ... Unfortunately, at the time of this writing, there is no native Linux version. You will have to use the SCO binary, and install the iBCS2-emulator for running ADSM. ... For a 2.0 kernel version, get ibcs-2.0-960610.tar.gz , unpack it in a suitable place, chdir into that directory, and apply the following patch: trace) Then, copy CONFIG.i386 to CONFIG , and type make . ...

Еще в разделе: (Показать все результаты (>535) - rtm-cs.sinp.msu.ru/ )

• Bridging mini-Howto
• Linux on Sony VAIO mini-HOWTO
• Handspring-Visor mini-HOWTO

FASTA /TFASTA/FASTX/TFASTXv3(1) FASTA /TFASTA/FASTX/TFASTXv3(1) NAME fasta3, fasta3_t - scan a protein or DNA sequence library for similar sequences tfasta3, tfasta3_t - compare a protein sequence to a DNA sequence library , translating the DNA sequence library `on-the-fly'. fastx3, fastx3_t - compare a DNA sequence to a protein sequence ... REF_URL the format string used to define the option to lookup the library sequence in entrez, or some other database. ...

Еще в разделе: (Показать все результаты (>4441) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/FBB/year_03/doc/term3/EMBnet_unix.pdf

Here is a description of the Filter/Driver Pack Plus release from Aldus. ... The Macintosh Filter/Driver Pack Plus includes several new and updated filters, including import filters for Microsoft Works 3.0 and MacWrite Pro files, as well as the most recent LaserWriter driver, version 8.1.1. ... The Filter/Driver Pack Plus also includes a patcher utility which will update PageMaker 5.0 to version 5.0a. This patcher corrects a handful of reported customer problems. ...

Еще в разделе: (Показать все результаты (>5369) - crydee.sai.msu.ru/ )

• The new precision concept
• Publications
• Installing the System

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... Inverse problems in mathematical physics . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>48) - rswater.phys.msu.ru/ )

... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• X-COM: DISTRIBUTED COMPUTING SOFTWARE | Moscow University Supercomputing Center
• Russian Supercomputing Days: Together to be Stronger | Moscow University
• APPLICATIONS: Theoretical Physics | Moscow University Supercomputing Center

NPAE 2012 4-th International Conference Current Problems in Nuclear Physics and Atomic Energy (NPAE-Kyiv2012) September 10 - 14, 2012 Kyiv, Ukraine Dear colleagues, This is the first circular of the 4-th International Conference on Current Problems in Nuclear Physics and Atomic Energy (NPAE-Kyiv2012), which will be held from September 10 to September 14, 2012 in Kyiv, Ukraine. ... 36, Kyiv), near Metro station Vasylkivska. ... Conference fee and registration Registration fee for participants 250 Euro. ...

Еще в разделе: (Показать все результаты (>322) - phys.msu.ru/ )

• Кафедра компьютерных методов физики