... 20 , 2014, , Outlines · Cosmological impact of new stable particles: direct and indirect searches for dark matter · Cosmological patterns of particle symmetry breaking: archioles, massive PBH clusters, antimatter domains . ... They are: · Inflation · Baryosynthesis · Dark matter/energy All these phenomena imply extension of the Standard Model of Strong (QCD) and Electroweak Interactions. ... Dark Matter from Charged Particles? ... Advances in High Energy Physics, vol. ...
... Сотрудники . ... Научная работа . ... Сверхпроводимость вызывает огромный интерес, т.к. передача электрического тока без энергетических потерь сулит огромные перспективы. Актуальность поиска соединений для электрохимической интеркаляции мультивалентных катионов, также как и разработки фундаментальных основ кристаллохимического дизайна таких соединений, связана с возрастающими потребностями в легких высокоэффективных возобновляемых химических источниках тока (ХИТ). МГУ им. М.В. Ломоносова . ...
... Архитектура пакета . ... Пакет содержит типы данных и алгоритмы для поддержки теории формальных языков в системе Maple. ... Для представления символов используется тип type/character , Для представления цепочек тип type/string . ... Основной новый тип: Language . ... Каталог с исходными текстами пакета имеет следующую структуру. src\ . ... Конструкторы и утилиты к типу Language . ... Конструкторы и утилиты к типу Acceptor . ... конструкторы объектов имеют префикс new , например: newLanguage() . ...
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...
... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...
[
Текст
]
Ссылки http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf -- 1512.1 Кб -- 23.03.2016
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/06/Academic-Guide-for-FGS-MSU.pdf -- 1512.1 Кб -- 27.06.2014 Похожие документы
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Current results . Scientific results . ... Human biomaterial . In recent years the emergence of new man-made environmental factors led to adverse (resulting in negative economic and social consequences) changes in the human population structure. This results in significant changes in the population structure, namely the reduction and disappearance of certain groups of the population (carriers of certain genetic, phenotypic, economic and cultural characteristics). ...
The Early Music Theatre >> Repertoire >> The Prophetess.. The Prophetess (The History of Dioclesian) is a masterpiece of the English Restoration opera. ... There is little good to say about most late Roman emperors. ... Muscovites know very well a Roman officer who suffered because of his religious beliefs under Dioclesian: the future martyr Saint George the Winner.) ... You shouldn't joke", the prophetess responded, "because you will become an emperor, Dioclus, when you kill Aprus". ...
. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...
ПРЕДСТАВЛЕНИЕ ЗАЙЦЕВА Михаила Владимировича, доктора физико-математических наук, профессора кафедры высшей алгебры механико-математического факультета МГУ на премию имени М.В. Ломоносова за научную деятельность На премию имени М.В. Ломоносова за научную деятельность выдвига-ется цикл работ М.В. Зайцева «Числовые инварианты полиномиальных тождеств». ... Codimensions of Algebras and Growth Functions.- ... Math. ... Codimension growth of special simple Jordan algebras.- ... J. London Math. ...
[
Текст
]
Ссылки http://scidep.math.msu.su/Sites/demosite1/Uploads/pred_Lom13_Zaicev.docs1.doc -- 29.5 Кб -- 22.05.2013 Похожие документы
... Астрономические данные в Сети - где искать и как пользоваться? Сайты с астрономической библиографией . ... Солнечные сайты . ... Астероидные сайты . ... http://www.uic.rsu.ru/astro/ А наиболее полный список на сайты по теме " что почитать по астрономии " (по-русски) можно найти в соответствующем разделе рейтингового каталога АстроТоп-100 . ... Прекрасная система поиска позволит Вам найти обзорные статьи практически по любому разделу современной науки - от физики и астрономии до химии и биологии. ...
... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc -- 102.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/methodsforfinancingfourcompany.doc -- 102.0 Кб -- 27.10.2005 Похожие документы
... Родился 28 августа 1965 г. Окончил физический факультет Московского Государственного университета им. М.В. Ломоносова в 1988 г. Специальность по образованию - физик. 1995 г. - защитил кандидатскую диссертацию. ... E-mail: larichev@optics.ru . ... Goncharov A.S., Iroshnikov N.G., Larichev A.V., Nikolaev I.P., The impact of speckle on the measurement of eye aberrations, 2014, Journal of Modern Optics, ? ... PDF . ... Goncharov A.S., Larichev A.V., Iroshnikov N.G., Ivanov V.Yu., ...
... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...
... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. March 25, 1999 . March of the Planets . ... Explanation: This March stargazers have been treated to eye-catching formations of bright planets in western evening skies. On March 3rd, looking toward a beautiful sunset from a beach on the Hawaiian isle of Maui, photographer Rick Scott recorded this fleeting, four-planet "hockey stick" array. ...
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы