... Field of research: physical-chemical gasdynamics, hypersonic aerothermodynamics, numerical simulation, physics of low-temperature plasma. e-mail: sakharov@imec.msu.ru . ... Field of research: physical-chemical gasdynamics, 3D hypersonic viscous gas flows, heat transfer, rarefied gas dynamics, analytical and asymptotic methods. ... Field of research: aerodynamics and destruction of the fire-balls in the atmosphere, hypersonic flow over bodies with physical-chemical changes, asymptotic methods. ...
... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...
. Евгений Вареник, 28 февраля 2006 . Схема Горнера вычисления значения полинома в точке. Доказательство ее оптимальности в худшем случае по числу операций "сложение" и "умножение" среди алгоритмов, использующих только эти операции. Материалы к докладу: . E.M. Reingold and A.I. Stokes, Simple proofs of lower bounds for polynomial evaluation, in: R.E. Miller and J.W. Thatcher, Eds., Complexity of Computer Computations (Plenum, New York, 1972) 21--29.
... ОБЩИЕ СВЕДЕНИЯ О СЕТИ ИНТЕРНЕТ . ... Краткая история развития сети . История Интернет уходит своими корнями в ранний период развития компьютеров и компьютерных сетей. ... Осуществление таких жестких требований на практике стало возможным только путем использования уже существовавших компьютерных сетей. ... Но в сети Интернет возможно осуществить и более сложный режим пересылки информации с удаленного компьютера, получивший название протокола FTP (File Transfer Protocol). ...
... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf -- 202.5 Кб -- 26.08.2013 Похожие документы
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...
... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...
... Men'shov I.S., Strong blast wave propagation in disperse mixture, Dokl. ... Men'shov I.S., Propagation of shock and detonation waves in dust-laden gases, Izvest. ... Men'shov I.S., Nakamura Y., Numerical Simulation of Nonequilibrium Air Flow over Spheres, in: Proc.27th Fluid Dynamics Conf., ... T. Saito, T. Nakamura, I. Men'shov, Y. Nakamura, Numerical Investigation of Ignition Overpressure Caused by Rocket Plume, Proceedings of the 35th Japan Fluid Dynamics Conference, Kyoto, Sep. 2003, pp. ...
... Гордов Е.П., Кабанов М.В., Лыкосов В.Н.. ... Гордов Е.П., Лыкосов В.Н., Крупчатников В.Н., Окладников И.Г., Титов А.Г., Шульгина Т.М. (Институт мониторинга климатических и экологических систем СО РАН и Томский госуниверситет, gordov@scert.ru; НИВЦ МГУ и ИВМ РАН; СибНИГМИ), "РАЗРАБОТКА ПРОГРАММНО-АППАРАТНОЙ ПЛАТФОРМЫ, ОБЕСПЕЧИВАЮЩЕЙ ФУНКЦИОНИРОВАНИЕ WEB-ОРИЕНТИРОВАННОГО ПРОИЗВОДСТВЕННО-ИССЛЕДОВАТЕЛЬСКОГО ЦЕНТРА В ОДНОЙ ИЛИ НЕСКОЛЬКИХ КОНКРЕТНЫХ ПРИКЛАДНЫХ ОБЛАСТЯХ НАУК ОБ ОКРУЖАЮЩЕЙ СРЕДЕ". ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
Lomonosov Moscow State University Biological faculty Botanical garden (Russia) (http://botsad.msu.ru/eng_news.htm) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The second information message Dear colleagues! ... Educational and enlightening activities based on collections of genus Iris L. The program of the Symposium will consist of plenary and sectional sessions as well as poster presentations. ...
[
Текст
]
Ссылки http://www.botsad.msu.ru/docs/eng_iris2.doc -- 901.5 Кб -- 24.02.2011
[
Текст
]
Ссылки http://botsad.msu.ru/docs/eng_iris2.doc -- 901.5 Кб -- 24.02.2011 Похожие документы
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...