... This assumption is grounded in the classical theory of stationary turbulence in the limit of infinite Reynolds number (e.g. Corrsin, 1951). ... The ratio of diffusivities is obtained as a function of buoyancy Reynolds number Reb and of the density ratio R (the ratio of the contributions of heat and salt to the density stratification). ... The main results are in section 5, where potential energy components, scalar variances and turbulent diffusivities for the two scalars are examined. ...

Еще в разделе: (Показать все результаты (>16) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/12/2004%20Kanamori%2C%20%20Brodsky%20The%20Physics%20of%20Earthquakes.pdf
• Index of /courses/geo/lib/books/Brown x26; Mussett The Inaccessible Earth/

Alexandra A. Zobova . NAME: Alexandra A. Zobova . ... AFFILIATION: Associate Position, Department of Theoretical Mechanics and Mechatronics, . Faculty of Mechanics and Mathematics, . Lomonosov Moscow State University . ADDRESS: Alexandra A. Zobova , . ... Moscow State University, 2008 . ... Laboratory Training for the students of the Theoretical Mechanics and Applied Mechanics and Control Departments . Lecture Course on 'Dynamics of the Systems of Solid Bodies with Friction' . ...

Еще в разделе: (Показать все результаты (>3) - www.theormech.math.msu.su/ )

• Moscow State Lomonosov University
• Кафедра теоретической механики и мехатроники механико-математического

... if (B1) { S1; } if (B1) { S1; } if (B2) { S2; } - - ...exp... int x = 1; if (x == 1) { std::cout << "Okay" << std::endl; } else { std::cout << "Error" << std::endl; } -- ­ int strlen(const char* p) { int len = 0; do { ++len; } while (*p++); return len; } «», «bbb» -- , : · ­ , , · ­ , , · ­ , · ­ . ... 1977 ­ LTL, · , 1981 ­ (CTL), · , , 1981 , , 1982 ­ model checking ( ), · , 1986 ­ model checking ( ), · , 1989 ­ SPIN. ... The Spin Model Checker: Primer and Reference Manual, Addison Wesley, 2003. ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

... Baybakov S.E., Bahareva N.S., Chuprunova N.S. Key questions of human physique theory (p. 31-41) During mathematical analysis of the height (H, m), mass (M, kg) and wrist circumference (C, dm) in 154 girls and 58 young men aged 19 years the fundamental dependence of expected body mass (Me) on its length, describing all normally built people, have been established (Me=kH3, where «k» was 12.68 conv. u for girls and 12.17 conv. u for young men). ... The analysis was conducted at two hierarchical levels....

Еще в разделе: (Показать все результаты (>22) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/index/k_20.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... Научные исследований . ... Дмитриев Владимир Иванович : Доктор физико-математических наук, профессор кафедры математической физики, . ... Научные работы : В.И. Дмитриев опубликовал более 400 научных работ, в том числе 22 монографии и учебных пособия. ... Барашков Игорь Сергеевич Кандидат физико-математических наук, старший научный сотрудник. ... Область научных интересов: математическое моделирование сложных физических явлений (плазмофизика, физика твердого тела, геофизика, физика атмосферы). ...

Еще в разделе: (Показать все результаты (>2) - lmph.cmc.msu.ru/ )

• Previous

... О кафедре . Кафедра суперкомпьютеров и квантовой информатики . ... Кафедра проводит обучение по образовательной программе шестилетней интегрированной подготовки высококвалифицированных специалистов с последовательным освоением образовательной программы бакалавриата (4 года) по профилю ?Системное программирование и компьютерные науки? и образовательной программы магистратуры (2 года) по двум магистерским программам: ?Суперкомпьютерные системы и приложения? и ?Квантовая информатика?. ... ИПМ РАН . ...

Еще в разделе: (Показать все результаты (>3) - sqi.cs.msu.su/ )

• Учебно-методические комплексы по курсам, читаемым преподаватлями кафедры ?

THE JOURNAL OF CHEMICAL PHYSICS 133, 144101 2010 Effective numbers of modes applied to analysis of internal dynamics of weakly bound clusters A. A. Rybakov,a E. D. Belega, and D. N. Trubnikov Department of ... Russia Received 11 June 2009; accepted 14 September 2010; published online 11 October 2010 The dependence of the volume of the chaotic component in the internal dynamics of triatomic van der Waals clusters on the angular ... When such difference is small, the regular motion disappears. ...

Еще в разделе: (Показать все результаты (>18) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/IJQC92.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/IJQC83.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/PCCP2.pdf

... Soc. 376, 1033­1046 (2007) doi:10.1111/j.1365-2966.2007.11549.x Kinematics and stellar populations of the dwarf elliptical galaxy IC 3653 I. V. Chilingarian,1 1 2 ,2,3 P. Prugniel, 2,4 O. K. Sil'chenko1 and V. L. Afanasiev 5 Sternberg Astronomical Institute of the Moscow State University, Universitetsky pr. ... Fitting the spectra with synthetic single stellar populations (SSP), we found an SSPequivalent age of 5 Gyr and nearly solar metallicity [Fe/H] =-0.06 dex. ... 2007 The Authors. ...

Еще в разделе: (Показать все результаты (>46) - sn.sai.msu.ru/ )

• MPFS reduction routines HELP

... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...

Еще в разделе: (Показать все результаты (>52) - genhis.philol.msu.ru/ )

... Морфология клеток и колоний диссоциантов бактерий . ... На этих сайтах размещены электронные каталоги, в которых можно осуществлять поиск научных работ по интересующему Вас вопросу. ... Поиск возможен по ключевым словам и их логическим комбинациям, названию, первым словам из названия, тематике и т.д. Самый большой выбор различных вариантов поиска. ... Присутствует большой выбор вариантов поиска: по автору, по названию, комментариям и т.д. Естественно, поддерживается логика (И/ИЛИ/НЕ). ...

Еще в разделе: (Показать все результаты (>12) - dis.bio.msu.ru/ )

... http://www.springer.com/materials/journal/339 . ... http://www.springer.com/physics/optics/journal/340 . ... http://www.elsevier.com/wps/find/journaldescription.cws_home/967/description#description . ... http://www.elibrary.ru/title_about.asp?id=2435&code=14644258 . ... http://www.springer.com/physics/optics/journal/10297 . ... http://www.springer.com/physics/optics/journal/10946 . ... http://www.springer.com/physics/optics/journal/11490 . ... http://www.elibrary.ru/issues.asp?id=809 . ... Физика. ...

Еще в разделе: (Показать все результаты (>4) - optics.sinp.msu.ru/ )

• НЕСТАЦИОНАРНЫЕ РЕЖИМЫ ГЕНЕРАЦИИ В ПРОТОЧНЫХ ЛАЗЕРНЫХ СИСТЕМАХ И НОВЫЕ

... 100 10 1 0.1 . ... 350 300 250 200 150 100 50 0 ( ) 318 95.1 0.816 1 0.107 0.055 14.6 17.2 0.0017 q q ( ) ( 6o) q , q ~ 4.7 . ... dM F = -G M dM r 2 r dA = F dr = R R =G M dM R(M) M M= 4 3 R 3 M 3 R = 4 1/ 3 M 1/ 3 4 A = G 3 1/ 3 0 M M 2/3 dM 4 A = G 3 1/ 3 1/ 3 3 5 5/3 G = 6.67 10 -11 /( ) 3 2 3 24 = 5518 / 4 A = G 3 1/ 3 M = 5.978 10 1/ 3 3 5 32 M 5/3 A 2.24 10 G = 6.67 10 -11 /( ) 3 2 3 24 : 6.12·106/ = 5518 / 4 A = G 3 1/ 3 M = 5.978 10 1/ 3 3 5 7 M 5/3 A / M 3.9 10 / ~2.24·1032 30000 oC 100 . ...

Еще в разделе: (Показать все результаты (>4) - geonew.phys.msu.ru/ )

• http://geonew.phys.msu.ru/junior_students/course_quot_fundamentals_of_geophysics_and_ecology_quot/2011%20Lecture%2007.pdf
• http://geonew.phys.msu.ru/junior_students/course_quot_fundamentals_of_geophysics_and_ecology_quot/2011%20Lecture%2005.pdf

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>7) - www.law.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>11) - imk.msu.ru/ )

... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...

Еще в разделе: (Показать все результаты (>7) - www.students.chemport.ru/ )

• Список слов, необходимых для сдачи экзамена по английскому
• тест ?5 по английскому языку

... Начало www.99ru.ru Антикварные Искусство 57 . ... Искусство . ... Введите код товара из каталога. автор Лев Канторович . ... Лондон, 21 сентября, Кристи. 1а. Канторович Лев Поход 'Сибирякова'. ... Л. 1934 вместе с 1в. Канторович Лев Оригинальные рисунки к Альбому 'Поход Сибирякова'. ... Эстимейт: 20.000-30.000 фунтов стерлингов*** Примечание: Несколько рисунков http://biblionne.narod.ru/190905.html#2 http://www.christies.com/LotFinder/lot_details.aspx?intObjectID=4828887 KANTOROVICH, LEV (ARTIST). ...

Еще в разделе: (Показать все результаты (>10) - www.bukivedi.ru/ )

• www.99ru.ru - Kraftwerk 15614
• www.99ru.ru - Radiohead 15841
• www.99ru.ru - Учебный курс 1927

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...

320. Институт Проблем Информационной Безопасности