. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .
... Porokhov, N., Kalabukhov, A., Chukharkin, M., Maresov, A., Khrykin, D., Klenov, N., and Snigirev, O. The physical basis of the fabrication of the third generation of high-temperature superconducting wires on quartz substrates.љ ... DOI љ] . ... Journal of Superconductivity and Novel Magnetism љ(2014). ... Сhukharkin, M., Kalaboukhov, A., Schnaiderman, J., Oisjoen, F., Jonsson, M., Xie, M., Snigirev, O., Winkler, D. Novel hts dc squid solutions for nmr applications. ... Superconducting electronics . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...
... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...
. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
О КАФЕДРЕ . ... Дело в том, что сильное землетрясение не является обособленным актом разрушения литосферы Земли. ... В физическом отношении землетрясение является процессом разрушения сильно неоднородного вещества Земли, а проблема выяснения физики сейсмического процесса сводится к проблеме прочности неоднородных структурированных сред. ... Мониторинг высотного здания МГУ . В 2005 году кафедра физики Земли выступила инициатором восстановления работ по мониторингу высотного здания МГУ . ...
... The delayed fluorescence of chlorophyll (DF) is an informative characteristic of the backward electron transfer in the reaction centers (RC) as well as of the functional activity of the photosynthetic apparatus (PSA) in vivo and in vitro under various physical and chemical factors (Hauvax, Lannoye, 1985; Rubin et al., ... Predominant bleaching of the long-wavelength fraction of chlorophyll provides evidence that oxidative reactions are located close to the reaction center of PSI. ...
The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...
[
Текст
]
Ссылки http://www.fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015
[
Текст
]
Ссылки http://fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015 Похожие документы
... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...
Молекулярная динамика . Расчетные методы симуляции молекулярной динамики базируются на представлениях классической механики, движение атомов описывается в формализме уравнений Ньютона для системы N взаимодействующих частиц: . Каждый атом считается находящимся в силовом поле, создаваемом другими атомами, сила взаимодействия будет выражаться как производная функции потенциальной энергии. ... Использование уравнений Ньютона автоматически приводит нас к классическому описанию движения атомов. ...
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...
. - ИСТОРИЯ ГАИШ - хроника, музей, персоналии, мемуары . ГАИШ В ЛИЦАХ . ПЕРСОНАЛИИ Астрономической обсерватории Московского университета и ГАИШ . АКСЕНОВ Евгений Петрович (11.10.1933, пос. Побединка, Рязанской обл. - 26.03.1995, Москва). Астроном, известный небесный механик. Отец, Петр Андреевич, токарь, мать, Анна Кузьминична - домохозяйка. В 1952 А. окончил школу в пос. Побединка и поступил на астрон. отделение мехмата МГУ. В 1957 окончил его и поступил в аспирантуру по небесной механике (рук. проф. Н.Д.
... Институт стран Азии и Африки . ... Экономика стран Азии и Африки . ... в различных группах стран Азии и Африки, а также изучение долговременных и современных тенденций их экономической модернизации, процесса догоняю- . ... 4.Социально-экономическая дифференциация развивающихся стран: . ... Экономический рост в странах Азии и Африки. ... Тенденции и факторы аграрного развития стран Азии и Африки. ... странами. ... Предпосылки и исходные рубежи современного экономического роста стран Азии и Африки . ...
... О факультете . ... Heng Zhang, Lei Li, Martin M?ller, Xiaomin Zhu, Jaime J. Hernandez Rueda, Martin Rosenthal, and Dimitri A. Ivanov*// From Channel-Forming Ionic Liquid Crystals Exhibiting Humidity-Induced Phase Transitions to Nanostructured Ion-Conducting Polymer Membranes "// Advanced Materials 25 (2013) 3543-3548. ... МГУ имени М.В.Ломоносова; авторы Герасин В.А., Иванов Д.А., Антипов Е.М. , Князев Я.В., Антипова Л.А., Гусева М.А. Список статей, опубликованных членами трудового коллектива . ...