... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...
Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf -- 583.5 Кб -- 21.09.2015 Похожие документы
. Кафедра истории зарубежной литературы . филологического факультета МГУ им. М.В. Ломоносова . Department of History of Foreign Literatures, Lomonosov State University of Moscow (MGU) . Новости и объявления . Кафедра . Преподаватели кафедры . Заседания кафедры . Диссертационный совет . Научное Студенческое Общество . Конференции . Издания кафедры . История кафедры . Учебная деятельность . Общие курсы (бакалавриат) . Спецкурсы и спецсеминары (бакалавриат) . Магистратура . Программы . Правила оформления
... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... For impatient users: You can download RusTeX in three different ways (Full installation; Selective download; Diskette-ready minimal installation) --- so at least read explanations about these methods before you download something. Please, use "Save link as" (right mouse button) for downloading files, otherwise .arj files and other binary files will be corrupted. ... TeX files are compact and readable in any text viewer: just text and commands for formatting and commands for equations drawing. ...
Оптоэлектроника на основе широкозонных полупроводниковых гетероструктур А3N и А2В6 Иванов Сергей Викторович Физико-технический институт им. А.Ф. Иоффе, Санкт-Петербург Среди бинарных полупроводников А3В5 за последние 20 лет наиболее активно и плодотворно развивались технологии, физика и приборные применения гетероструктур А3-нитридов (AlGaIn)N. Это привело 7 октября ... Phys. Status Solidi A 210, 439 (2013), feature paper. ... Phys. 114 , 124306 (2013). ... 7] S.V. Ivanov et al., ...
[
Текст
]
Ссылки http://cm.phys.msu.ru/vfiles/12nov14/IvanovSV_abstract_12nov14.doc -- 44.0 Кб -- 11.11.2014 Похожие документы
... Advanced chapters of operation research . Algebraic characterization of basic solution of linear program. ... Advanced chapters of Actuarial Mathematics . ... Discounted cash flow analysis and capital budgeting as decision tools are given particular emphasis. ... In the first part of the course we present a modern approach to modeling economic systems. ... The problem of tax optimization under a given financing budget. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
Дата проведения турнира . ... Регистрация до 16.05.2006 Расписание турнира: 14-30 - начало регистрации. 15-00 - начало игр. ... Система проведения: 2.1 Максимальное количесво команд 16, одновременно играют 4 команды (2 игры), система Full Double elimination 2.2 Команды играют до 13 выигранных раундов: по 12 раундов за террористов и контртеррористов. ... 2.10 Первая половина игры начинается, когда все Игроки зайдут на сервер за свои стороны и Капитаны команд подтвердят готовность к игре. ...
... ОБЩИЕ СВЕДЕНИЯ О ПЕРЕМЕННЫХ ЗВЕЗДАХ . ... Структура Общего каталога переменных звезд . ... Традиционные обозначения переменных звезд опираются на название соответствующего созвездия, поэтому информация о переменных звездах в ОКПЗ представлена по созвездиям, в порядке латинского алфавита их названий (полных, а не сокращенных; см. ... В первом и последнем столбцах как левой, так и правой страницы разворота представлены обозначения переменных звезд каждого созвездия по исторически сложившейся системе. ...
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... AMD выпускает процессор Fusion, совмещающий универсальный и графический процессоры на одном кристалле. 1 июня 2010 года . ... В Tokyo Tech будет установлен суперкомпьютер TSUBAME 2.0 производства NEC и Hewlett-Packard на базе процессоров Intel Westmere-EP и Nehalem-EX, а также ГПУ NVIDIA Fermi с пиковой производительностью 2.4 PFlop/s. 28 мая 2010 года . ... Выпущена версия 1.0 программного обеспечения Jacket, реализующего MATLAB на графических процессорах NVIDIA. 28 ноября 2008 года . ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...
Old-MGU" expedition on Zagedan . NEW!! ... I say "old-MGU" because only two of us (Gusev and Mushenkov) are "real members of MUCC". ... O. Shul'ga Zagedan was a new region for us, nobody from MGU have ever been there. ... I'm afraid that now they'll go to Zagedan, because the deepest cave of Russia (Gorlo Barloga, 770m) is located now here. ... We worked on a rather small area, basically in two caves- "Podsnezhnik" and "Dorbun-tur" (they are marked by greek letters "psi" - psi-1 and psi-2). ...
... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...