... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

• http://www.edst.msu.ru/conf/docs/Bologne.doc

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>5) - depository.msu.ru/ )

• Road map | depozitariy
• Animals | depozitariy

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Resources for Textual Content Compression
• Lexical Resources for Personal Data Recognition in Texts

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>3) - tukachev.flogiston.ru/ )

. Scobeltsyn Institute of Nuclear Physics , . Moscow State University , . Experimental High Energy Physics Department . RU-119899, Moscow, Russia . Phone (work) :(+7)(095)939-5881 . Fax :(+7)(095)939-3064 . E-mail : dudko@lev.art.ru . (.ps.gz) . (.ps.gz) , pdf . (.ps.gz) , pdf .

Еще в разделе: (Показать все результаты (>10) - top.sinp.msu.ru/ )

... В.Е.Фортов, В.К.Грязнов, А.А.Леонтьев, В.Б.Минцев, В.Е.Беспалов, Ю.В.Иванов IV Всесоюзная конференция по физике низкотемпературной плазмы. ... Experimental study of a dense xenon plasma under high pressures. V.B.Mintsev Proc. of 2-d Int.workshop on non-ideal plasmas. ... Yu.B. Zaporogets, V.B.Mintsev, V.E.Fortov In book: Current topics in shock waves, New York, 1989, p.549-555. ... Strongly coupled plasma physics at megabar pressures V.E.Fortov, V.B.Mintsev In book: High Pressure phenomena. ...

Еще в разделе: (Показать все результаты (>6) - www.test.physchem.msu.ru/ )

... WRF (Weather Research and Forecasting Model) [9]. ... NOAH LSM (National Centers for Environmental Prediction, Oregon State University, Air Force, Hydrology Lab-NWS Land Surface Model) [3]. ... WRF ­ (Urban Canopy Model, UCM) [6] (Building Environment Parameterization, BEP) [8]. ... C ­ ( HA = r · HR + rw·Ha ). , r ­ ( UCM NOAH LSM « » , , , (, .) H = A H ­ , LSM +A HA , (, H ­ ; A , , ); A ­ , (, , ); HLSM ­ , NOAH LSM; HA ­ , UCM. ... 48 1 29 2007 00 . ... WRF) : - NOAH; UCM - ; BEP - . ...

Еще в разделе: (Показать все результаты (>5) - atm563.phys.msu.ru/ )

• http://atm563.phys.msu.ru/rus/gidromet_public_html/trudy/thmc3440111.pdf

... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...

Еще в разделе: (Показать все результаты (>35) - ecology.genebee.msu.ru/ )

• Персональные страницы
• Научная программа
• Кафедра общей экологии

... BMC Genomics 2013, 14:745 http://www.biomedcentral.com/1471-2164/14/745 DATABASE Open Access RegPrecise 3.0 ­ A resource for genome-scale exploration of transcriptional regulation in bacteria Pavel S Novichkov1*, Alexey E Kazakov1, Dmitry A Ravcheev2,3, Semen A Leyn2, Galina Y Kovaleva1,2, Roman ... Inna Dubchak1 and Dmitry A Rodionov 2,3* Abstract Background: Genome-scale prediction of gene regulation and reconstruction of transcriptional ... Figure 5 The regulog page in RegPrecise. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/jbcb_2006.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

Вы посетили: inv_engl.html . ... История кафедры . ... Visiting Professor at the University of Oslo, Norway, Oslo, November, 2010 . ... Visiting Professor at the University of Ljubljana, Slovenia, August, June 2010 . ... Visiting Professor at the University of Patras and the University of Athens, Greece, June-July 2009 . ... Visiting Professor at the University of Stockholm, Sweden, January ? ... staff/guterman/inv_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>16) - halgebra.math.msu.su/ )

• staff:guterman:int_engl.html | Кафедра высшей алгебры
• staff:guterman:grants_engl.html | Кафедра высшей алгебры
• staff:guterman:activ_rus.html | Кафедра высшей алгебры

... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....

Еще в разделе: (Показать все результаты (>2) - biophys.phys.msu.ru/ )

... Akhmetjev Petr Mikhajlovich . Moscow, Russia) . Allyonov Segrej Vladimirovich . Kolomna, Russia) . ... Bielefeld, Germany) . Balashchenko Vitalij Vladimirovich . ... Belgrade, Serbia and Montenegro) . ... Davydov Ostap Mikhajlovich . Chelyabinsk, Russia) . ... Novy Pazar, Serbia and Montenegro) . Doubrov Boris Mikhajlovich . ... Greifswald, Germany) . ... Ershov Andrej Vladimirovich . ... Melikhov Sergej A. (Moscow, Russia) . ... Podgorica, Serbia and Montenegro) . ...

Еще в разделе: (Показать все результаты (>26) - dfgm.math.msu.su/ )

• Links

SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...

Еще в разделе: (Показать все результаты (>6945) - mouse.belozersky.msu.ru/ )

• Geometrical core

... 2011 . 2012 ., ... 1) 97% , () 100 96%, ­ 92%; 2) 72%, ­ 85%, , , ­ , 70%. ... 93% 2010 ., ... 100 % () , , 2010 / 2011 , 13 ZYRYANOV V., KOTLOBOVSKY I., SINYAKOV A. UNIVERSITIES PREPAREDNESS TO IMPLEMENT THE FEDER AL STATE : EDUCATIONAL STANDARDS: ORGANI ZATIONAL ASPECT The article continues to present the results of monitoring the implementing effectiveness of the federal state educational standards ( FSES ) of higher education institutions conducted by the Association of Classical ...

Еще в разделе: (Показать все результаты (>13) - www.umo.msu.ru/ )

• http://www.umo.msu.ru/docs/projects/monitoring/mon_effect_fgos_8-9_12.pdf

... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 29/09/2015 . ... Natural resousces management? The purpose of the "Natural resources management" Master?s Degree programme is to educate specialists in the field of natural resource management, environmental management, sustainable development of regions and densely urbanized territories. ...

Еще в разделе: (Показать все результаты (>3) - www.hsib.msu.ru/ )

• Master Degree in Chemistry | Высшая школа инновационного бизнеса МГУ

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

• The NVIDIA Graduate Fellowship Program | GPU Center of Excellence МГУ

... mechanic . ... engineer . ... senior researcher . ... 77 (floor -1) . ... Fedoseev Anatoly Ivanovich . docent . ... spekl@phys.msu.ru . ... Hlystov Vladimir Ivanovich . ... Ivanov Sergey Nikolaevich . leading engineer . 939-31-69 . sni@opts.phys.msu.ru . ... iak@opts.phys.msu.ru . ... Kolobanov Vitaly Nikolaevich . ... 2-07 (SINP MSU) . ... korolenko@optics.npi.msu.su . ... junior researcher . ... researcher . ... researcher (SINP MSU) . ... 71 (floor -1), 4-13(SINP MSU) . ...

Еще в разделе: (Показать все результаты (>2) - opts.phys.msu.ru/ )

• http://opts.phys.msu.ru/eng/menu.html

... research | ... Matvey Viktorovich Youdov . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... B.S./M.S. in Chemistry "Study of structure of humic substances and their hydrolysis products by 1H and 13C nuclear magnetic resonance spectroscopy techniques" Employment: . ... Current research activity is dealing with investigation of structure of hydrolyses products of humic substances by methods of NMR spectroscopy. | ...

Еще в разделе: (Показать все результаты (>4) - www.mgumus.chem.msu.ru/ )

• MGUMUS -- Anna N. Bolkova
• MGUMUS -- Ekaterina A. Ilyukhina