... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
MultiTest V.1.2, a program to binomially combine independent tests and performance comparison with other related methods on proportional data Thierry De MeeШs1,2*, Jean-FranГois GuИgan2 and Anatoli Teriokhin3 1 IRD, UMR 177 IRD-CIRAD "Trypanosomoses", Centre International de Recherche-DИveloppement sur l'Elevage en zone Subhumide (CIRDES), 01 BP 454, Bobo-Dioulasso 01, Burkina-Faso. ... All procedures more or less behaved consistently with ~5% significant tests at ?= ... and number of species in | ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc -- 360.0 Кб -- 11.08.2009 Похожие документы
... West European and American literature and culture of XIX-XX centuries, literature as discourse, reception studies, history of the book . ... Moscow University Press, 1994. ... W. Stevens. тАУ History of American Literature. ... Board Member, Administrative Board of Moscow University . Board Member, Administrative Board of the School of Philology, Moscow University . Board Member, Specialized Dissertation Board for West-European and Slavic Literatures, School of Philology, Moscow University . ...
About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...
... A new mechanism governing the dynamics of territory changing between groups of people such as countries is proposed based on trading with approval of both sides under particular voting rule (veto rule, majority rule, etc.) ... A state equation is obtained based on particular personal utility function. ... The countries which have approximately the same marginal 4 utility of the territory at the border would fight rather than trade as a result of equilibrium in the corresponding game. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...
[
Текст
]
Ссылки http://physcontrol.phys.msu.ru/materials/aal/CV_Lazarev_2012.pdf -- 455.1 Кб -- 15.05.2014 Похожие документы
Chlorophyll Fluorescence in vivo : A Theory (Part II). ... The model of carbon assimilation V c ( m M C m -3 s -1 ) by phytoplankton is based on light dependence of photosynthesis , which can be described by a coefficient of underwater radiation absorption by photosynthetic pigments of photosystem II in suspension of microalga a PSP (m -1 ) averaged over the spectral range of underwater radiation, where ... According this assumption the photosynthesis rate is equal to: . ...
Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...
The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...
[
Текст
]
Ссылки http://www.fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015
[
Текст
]
Ссылки http://fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015 Похожие документы
Index of Journals and Publishers . You can find some material through alphabetical list, here are publisher's and journal's lists. ... Main journals" list contains the most significant science magazines, like Nature , Cell , Science , PNAS and etc.. Physico-chemical biology" list contains magazines whitch is used very often by biologists of Belozersky institute, it had been gathered by Vladimir Melgunov. The "Classification" allows you to watch all journal in specific category. ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... Author: Гаина Алексей . Subject: HISTORY of ASTRONOMY: V.A. ALBITZKY(Russian and English) . ... Nachr., ... 1928, Izvestia GAO Poulkovo, Vol. ... 1941, Izvestia KrAO, vol. ... KrAO, vol. ... 1947, Izvestia KrAO, vol. ... KrAO . ... Subject: 20-летие школы "Квантовые частицы в интенсивных полях" . ... 3 мая исполняется 20 лет со дня открытия в Молдавии школы молодых ученых "Квантовые частицы в интенсивных полях". История школы такова: . ... 4 мая, утро . ... Кууск П. 7 мая, утро . ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
Dynamical Chaos and Nonlinearity Udmurt State University, Universitetskaya, 1 426034, Izhevsk, Russia E-mail: mamaev@rcd.ru EULER POISSON EQUATIONS AND INTEGRABLE CASES Received April 18, 2001 DOI: 10.1070/RD2001v006n03ABEH000176 In this paper we propose a new approach to the We make a new investigation of Kovalevskaya and Goryachev Chaplygin cases of Euler Poisson equations and obtain many new results in rigid body dynamics in absolute space. ... Fig. ... Bobylev Stekloff solution. ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/38e/121-euler-poisson-equations-and-integrable-cases_ru.pdf -- 1440.8 Кб -- 28.10.2015 Похожие документы