... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

Roman Sutormin rsutormin@gmail.com Professional experience 05/2013 ­ present: Lawrence Berkeley National Laboratory (Berkeley, CA, USA) Software developer Development of JSON based storage system used for keeping biological data involved in public KBase services. ... 10/2009 ­ 08/2011: Mail.Ru Group (Moscow, Russia), Software developer Support and development of data warehouse (PostgreSQL) and administration web tool (JBoss + GWT) on serverside of MMO game "Allods Online". ... 2013 Jul 1514(1):476. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/genome_biol_evol_2014.pdf

... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...

Еще в разделе: (Показать все результаты (>3) - www.iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2010/vaish_ea.pdf

МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... Art Criticism and History . ... Economics . ... Chairman : Professor, Doctor of Technical Science Kravets Victor A. ( Deputy director of science) . ... Chairman: Professor, Doctor of Economics, academician, Full member of the Russian Academy of Sciences Nekipelov Alexander D. ( Director of Moscow School of Economics department of Moscow State University) . ... World economy (Professor, Doctor of Economics Glinkina Svetlana P.) . ...

Еще в разделе: (Показать все результаты (>11) - conf.msu.ru/ )

Evolutionary Ecology 1998, 12, 291±307 Evolutionarily optimal age schedule of repair : Computer modelling of energy partition between current and future survival and reproduction ANATOLY T. TERIOKHIN Department of Biology, Moscow State University, Moscow 119899, Russia Summary The aim of this study was to ... Let us now look at the inЇuence of the level of external mortality, associated with the parameter , on the optimal energy partition between reproduction and current survival. ...

Еще в разделе: (Показать все результаты (>26) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>4) - erp.cmc.msu.ru/ )

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the protein­protein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>16) - www.library.biophys.msu.ru/ )

.. .. .. « » 01 -07 .., . «» 2010 532.516.532.517 35.114 43 43 « » 01 - 07 2010 . . . . «» ­ : . 2010. - 196. . . , . 532.516.532.517 35.114 © . .., 2010 XIX - () « » 1 7 2010 . «» . 60 , 14 . : ( ) , ( , ) . 42 30 . .. .. ­ .. , .. .. « ». . .. , .. , .. ( . ), .. , .. , .. (. ), .. , .. (. ) .. (. --). , 1976. . .. . , 30 «» - 3 , . .. (15 2009) .. (25 2008). , .. .. . - , . . . ..-.. .. 4 « » 1. .. . 2. .. . 3. .. ( , ) . 4. .., .., .., .. «» . 5. .. - . 6. .. . 7. .. - . 8. .. . 9. .., .., .. 5 . . 10.

Еще в разделе: (Показать все результаты (>8) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc

... Beklemishev M.K., Kuzmin N.M., Kardivarenko L.M. Extraction of silver complexes with aza-analogues of dibenzo-18-crown-6. ... Beklemishev M.K., Stoyan T.A., Dolmanova I.F.. ... Efremova T.A., Beklemishev M.K., Shumsky A.N., Dolmanova I.F. Determination of manganese by a catalytic method using oxidation of 3,3',5,5'-tetramethylbenzidine with potassium periodate. ... Kapanadze A.L., Beklemishev M.K., Dolmanova I.F. Determination of organophosphorus pesticides by a catalytic method on TLC plates. ...

Еще в разделе: (Показать все результаты (>19) - analyt.chem.msu.ru/ )

• Moscow State University: Analytical Chemistry Division

Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Cambridge Journal of Economics . ... Capital Markets Law Journal . ... Chemical Biology . ... Clinical & Experimental Allergy . Clinical & Experimental Allergy Reviews . Clinical & Experimental Immunology . Clinical & Experimental Ophthalmology . Clinical and Experimental Dermatology . Clinical and Experimental Optometry . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - wwwlib.phys.msu.ru/ )

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>3) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>3) - do.chem.msu.ru/ )

... 6:30 - 7:00pm |Transit to Executive Learning | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | ... 10:30 - 10:45am |Funds |Executive Dining Room | Claude Legrand |10:45am - 12:30pm|Refreshment Break |ELC x.206 | ... 10:30 - 10:45am |Refreshment Break |Executive Dining Room | ... Lunch |Executive Dining Room | ... 2:30 - 2:45pm |Refreshment Break |Executive Dining Room | ... 4:00 - 4:15pm |Refreshment Break |Executive Dining Room | ... 5:15 - 5:30pm |Refreshment Break |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

• http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Nov4-Nov12_2007.doc

VARIABLE STARS, THE GALACTIC HALO AND GALAXY FORMATION C. Sterken, N. Samus and L. Szabados (Eds.) 2010 Formation Mechanisms for Spheroidal Stellar Systems O. K. Sil'chenko 1 Sternberg Astronomical Institute of the Moscow State University, Moscow, Russia Abstract. Spheroidal stellar systems on various scales include elliptical galaxies, dwarf spheroidal galaxies, and globular stellar clusters. ... The formation mechanisms of the oldest globular clusters represent a puzzle yet. ... 2009). ...

Еще в разделе: (Показать все результаты (>47) - sn.sai.msu.ru/ )

• MPFS reduction routines HELP
• Recent publications

... Structure of Data . ... Catalog . ... In SAI OCL Catalog, we introduce our work on investigation of the Milky Way system of open star clusters. The main goal of our study is a search for new clusters using huge surveys. 168 new clusters have been already discovered by us using J,H,Ks data from 2MASS point source catalog. ... For 141 new clusters, we found their physical parameters using J,H,Ks data from 2MASS catalog and, for a number of clusters, our UBVRI CCD observational magnitudes. ...

Еще в разделе: (Показать все результаты (>2) - ocl.sai.msu.ru/ )

... Opportunities for Research Section Financial and Legal Mechanisms for Developing Russia in the Context of Global Political and Economic Instability Chairperson: Professor Alla Bobylyova Head, Department of Financial Management, School of Public Administration Lomonosov Moscow State University Secretary: Olga Lvova Department of Russian History, School of Public Administration Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>29) - www.spa.msu.ru/ )

• Содержание выпусков
• Сотрудники факультета госуправления

ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...

Еще в разделе: (Показать все результаты (>2) - oc.cs.msu.ru/ )

THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...

Еще в разделе: (Показать все результаты (>5) - www.law.msu.ru/ )

• http://www.law.msu.ru/bitcache/da2ecb4c4c1ad0c8d4c795e346afcf80b93bd045?vid=25267&disposition=attachment&op=download

This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...

280. Conductor | Academic choir of Moscow State University