About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>2) - textbook.sinp.msu.ru/ )

... Sov.Phys.-Plasma Phys.) 1978.V.4. ... Timofeev I.B., Bychkov V.L. Influence of ionizing processes on the lifetime of plasma ball in air. ... Bychkov V.L. Database on ball Lightning for PC. ... Bychkov V.L., Bychkov A.V., Stadnik S.A. Polymer Fire Balls in Discharge Plasma. ... Emelin S.E., Bychkov V.L., Astafiev A.M., Kovshik A.P., Pirozerski A.L. Role of discharge products throttling for generation of ball lightning with a condensed core from a high pressure vapor - gas phase Proc. 11-th Intern. ...

Еще в разделе: (Показать все результаты (>3) - physelec.phys.msu.ru/ )

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>6) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/nvidia_hpc_day.pdf
• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>14) - imk.msu.ru/ )

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ­ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>11) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/jbcb_2006.pdf

... 7.1] Lectures of prof. Scrucca in Advanced quantum field theory (e.g., for the first study of the worldline formalism): http://itp.epfl.ch/webdav/site/itp/users/181759/public/aqft.pdf . ... I. Topological quantum effects Lecture 1 (Spring 2015) , The Outline Before Casimir: the van der Waals forces (presentation, pdf) . ... Lecture 5 (Fall 2015) , Lattice field theory: 'free fields' (presentation, pdf) . Lectures 6-7 (Fall 2015) , Lattice field theory: 'interacting fields'. ...

Еще в разделе: (Показать все результаты (>6) - theorphys.phys.msu.ru/ )

• Славнов Андрей Алексеевич
• Kirill A. Kazakov

... The Sixth International Conference «Scientific Issues in Security and Combating Terrorism », Moscow, 11 - 12th of November, 2010 The Council of Europe approach to the international information security in the context of the fight against terrorism Ms. Marta Requena, Head of the Public International Law and Anti- Terrorism Division Head of the Counter Terrorism Task Force, Council of ... States certainly remain the principle actors of the fight against terrorism. ...

Еще в разделе: (Показать все результаты (>4) - www.iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2010/vaish_ea.pdf

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Information . ... Address: 119234, Moscow, Leninskie Gory St., 1, Lomonosov Moscow State University, Mechanics and Mathematics Faculty, the Entrance Examinationљletter with acknowledgment of receipt and list of contents. ... Plan of recieving is 90 students (60 to mathematics, 30 to mechanics). ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>5) - pk.math.msu.ru/ )

• Master programme | Mechmath admission for internetional students
• First Education | Mechmath admission for internetional students

... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• Государственное управление. Электронный вестник

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>11) - lhe.sinp.msu.ru/ )

• How to migrate from Pine to Evolution

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

275. http://ms.cs.msu.ru/index.php?option=com_cbcontact&Itemid=37

276. Best search engines for finding scientific information in the Internet:

277. http://tunka.sinp.msu.ru/en/presentation/Dedenko.pdf

278. Лаборатория Термохимии МГУ

279. http://geophys.srcc.msu.ru/library/zilitinkevich_et_al.pdf

280. Кафедра квантовой теории и физики высоких энергий