The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

... Если вы заинтересованы участвовать в работе Симпозиума, мы просим вас направить по электронной почте в адрес Оргкомитета (motility2006@iteb.ru) заполненные регистрационные формы до 1 февраля 2006 года и направить ваши тезисы до 15 марта 2006 года. ... Тезисы должны быть присланы по электронной почте вложенным файлом (предпочтительно) по адресу motility2006@iteb.ru или на дискете по адресу 142290, Институт теоретической и экспериментальной биофизики РАН, г. Пущино, Московской обл., ...

Еще в разделе: (Показать все результаты (>3) - muscle.imec.msu.ru/ )

Публикации Кучериненко Я.В. Назад в каталог . ... А.А.Ордин, Я.В.Кучериненко. ... A.A.Ordin, Ya.V.Kucherinenko. ... Percolation approach to grain boundary wetting: theory, computer simulation and experiment. ... 2003 . ... International workshop INTERFACES IN ADVANCED MATERIALS, IAM-03, Chernogolovka, Moscow district, Russia, 26-30 May, 2003 2004 . ... Kucherinenko and B. Baretzky. 3-dimensional Wulff diagrams for S3 grain boundaries in Cu // REVIEWS ON ADVANCED MATERIALS SCIENCE, 6 (2004), pp.23-31. ...

Еще в разделе: (Показать все результаты (>38) - cryst.geol.msu.ru/ )

... The kinematics, structure, and stellar population properties in the centers of two early-type spiral galaxies of the Leo Triplet, NGC 3627 and NGC 3623, are studied by means of integral-field spectroscopy. ... In the center of NGC 3627 we observe noticeable gas radial motions, and the stars and the ionized gas in the center of NGC 3623 demonstrate more or less stable rotation. ... In this work we consider two nearby early-type spiral galaxies belonging to the famous Leo Triplet, NGC 3623 and NGC...

Еще в разделе: (Показать все результаты (>49) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/ar281.pdf
• http://sn.sai.msu.ru/~sil/preprints/204780.pdf
• http://sn.sai.msu.ru/~sil/preprints/ic719.pdf

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>5) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

. # ....... # S ....... S T ..... E R . Q U E . C N ..... T C ....... U # ....... R E ..... E S . S .

Еще в разделе: (Показать все результаты (>8) - mouse.belozersky.msu.ru/ )

• Geometrical core
• wLake program homepage

... Структура факультета . ... История юридического факультета . ... Сайт студенческих консультаций юридического факультета МГУ . ... Читать далее . ... 2 августа 2014 г. празднует юбилей специалист по учебно-методической работе учебного отдела юридического факультета МГУ Елена Владимировна Буданова. ... 2 августа 2014 г. отмечает 60-летие доктор юридических наук, профессор кафедры гражданского процесса юридического факультета МГУ Валерий Владимирович Молчанов. ... Юридический факультет МГУ, 2009. ...

Еще в разделе: (Показать все результаты (>2) - old.law.msu.ru/ )

International Conference Fluxes and Structures in Fluids : Physics of Geospheres FLUXES AND STRUCTURES IN FLUIDS : PHYSICS OF GEOSPHERES International Conference PROGRAMME FLUXES AND STRUCTURES IN FLUIDS CO-SPONSORS RUSSIAN ACADEMY OF SCIENCES RUSSIAN FOUNDATION FOR BASIC RESEARCH NATIONAL SCIENCE FOUNDATION (USA) THE CONFERENCE IS ORGANISED BY ... D.M. Klimov (Russia), Prof. S. Kimura (Japan), Acad. ... Coffee Break 2-nd Morning Session 11:30 ­ 13:00 Section 1 11:30 ­ 11:45 .. ...

Еще в разделе: (Показать все результаты (>16) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/12/2004%20Kanamori%2C%20%20Brodsky%20The%20Physics%20of%20Earthquakes.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2006%20Wood%20et%20al.%2C%20Accretion%20of%20the%20Earth%20and%20segregation%20of%20its%20core.pdf
• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf

... Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. ... GBE exon intron exon intron exon Acceptor splice site Consensus Nonconsensus -24-23-22 -21-20-19-18-17-16 -15-14-13-12 -11-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 +1 Position number -3 -2 Donor splice site -1 +1 +2 +3 Position number +4 +5 +6 FIG.1.- ...

Еще в разделе: (Показать все результаты (>9) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/jbcb_2006.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>18) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

... 21 Дек 2015 . кем editor | ... Декабрь 2015 . Ноябрь 2015 . Октябрь 2015 . Сентябрь 2015 . Май 2015 . Март 2015 . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate ...

Еще в разделе: (Показать все результаты (>80) - elana.sinp.msu.ru/ )

• I couldn?t help but stop in on the Russians observe them slide. Was fortunate
• ralph lauren outlet uk 6 million cars worldwide | С Днем Победы!
• September 28-October 19. Men season even more refined. Astro Boy the little

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...

Еще в разделе: (Показать все результаты (>9) - theorphys.phys.msu.ru/ )

• Сарданашвили Геннадий Александрович

... NetCDF User's Guide for C . abnormal termination aborting define mode definitions access example of array section other software for scientific data random shared dataset [1] [2] access to netCDF distribution FTP WWW adding attributes [1] [2] dimensions [1] [2] variables [1] [2] add_offset attribute [1] [2] ancillary data [1] [2] APIs descriptions differences between C and C++ differences between C and FORTRAN summary of C appending data along unlimited dimension to dataset ...

Еще в разделе: (Показать все результаты (>24) - angel.cs.msu.su/ )

• PhD Summer School on Scentific Computing
• Summary
• Foreword

... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...

Еще в разделе: (Показать все результаты (>10) - geophys.srcc.msu.ru/ )

• Лаборатория суперкомпьютерного моделирования природно-климатических процессов

... Данный раздел информационного портала посвящен основным конференциям по тематике ПЛИС, проходящим как в мире, так и в России. FPGA 2010 - Eighteenth ACM/SIGDA International Symposium on Field-Programmable Gate Arrays. ReConFig'09 - 2009 International Conference on ReConFigurable Computing and FPGAs. ИКТМР-2009 . ... 2009 Symposium on Application Accelerators in High-Performance Computing (SAAHPC'09) . RAW 2009 . ... 5th International Workshop on Applied Reconfigurable Computing. ...

Еще в разделе: (Показать все результаты (>3) - fpga.parallel.ru/ )

• Журналы, посвященные реконфигурируемым системам

ELSEVIER Bioelectrochemistry and Bioenergetics 35 (1994) 39-47 Modelling of the effect of a weak electric field on a nonlinear transmembrane ion transfer system G.Yu. ... Aksyonov Biological Faculty of Moscow State University, 119899Moscow, Russian Federation Abstract A mathematical modelling of the K+ /H+ antiport system was carried out to investigate the influence of a weak low-frequency applied periodic electric field on ion flux via a carrier across the lipid membrane. ... Its fre- w Fig. ... Fig. ...

Еще в разделе: (Показать все результаты (>36) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3413.pdf
• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/matorin/3400.pdf

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...